We narrowed to 7,967 results for: 11
-
Viral Prep#139504-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-CAG-DIO-PPO-Venus (#139504). In addition to the viral particles, you will also receive purified pAAV-CAG-DIO-PPO-Venus plasmid DNA. CAG-driven, Cre-dependent expression of Venus-tagged parapinopsin. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsVenusAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pSpCas9(BB)-2A-Puro (PX459) V2.0
Plasmid#62988PurposeCas9 from S. pyogenes with 2A-Puro, and cloning backbone for sgRNA (V2.0)DepositorInserthSpCas9-2A-Puro V2.0
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCbhAvailable SinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro CAG FUCCI
Plasmid#136934Purposedonor plasmid for constitutive FUCCI expression in human cellsDepositorInsertClover-Geminin(1-110)-IRES-mKO2-Cdt(30-120)
UseSynthetic BiologyTagsClover and mKO2ExpressionMammalianPromoterCAGAvailable SinceApril 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xEcoLeuT(CUA)_EF1_sfGFP150TAG
Plasmid#174892Purposeamber suppression reporter sfGFP150TAG with EcoLeuT(CUA) amber suppressor tRNA cassetteDepositorInsertsfGFP
ExpressionMammalianMutation150TAG in sfGFPPromoterEF1Available SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0
Plasmid#62987PurposeCas9n (D10A nickase mutant) from S. pyogenes with 2A-Puro, and cloning backbone for sgRNA (V2.0)DepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationCas9 D10A nickase mutantAvailable SinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPUR-mU6-sgRNA-2XPP7
Plasmid#194504PurposeEmpty backbone for sgRNA-2XPP7 in CRIPSR FISHer systemDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pB-Neo-rTOM20-GFP
Plasmid#210331PurposeOverexpression of rTOM20DepositorAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-TORCAR
Plasmid#64927PurposeFRET-based biosensor for monitoring mTORC1 kinase activity.DepositorAvailable SinceJuly 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1363 LV EF1a-CD19 IRES-EGFP
Plasmid#201919Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD19DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cyto-ExRai-CKAR2
Plasmid#236097PurposeCytosol-targeted enhanced excitation-ratiometric biosensor for monitoring Protein Kinase C activity in living cells.DepositorInsertExRai-CKAR2-NES
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceMay 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HA-JMJD2A
Plasmid#24180PurposeMammalian expression of human JMJD2A with HA tagDepositorAvailable SinceJan. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3/V5-DEST-GFP
Plasmid#40125DepositorInsertGFP
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceJuly 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
pB-mTSPAN4-GFP
Plasmid#210329PurposeOverexpression of mTSPAN4DepositorAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_cAMPFIRE-M
Plasmid#182280PurposeMammalian expression of the cAMP sensor cAMPFIRE-M under a CMV promotor.DepositorInsertcAMPFIRE-M (cAMP sensor)
ExpressionMammalianAvailable SinceMarch 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
DT0
Plasmid#80418PurposeExpresses 0 CUG repeats in the context of human DMPK genomic segment containing exons 11-15 with repeats inserted at site in exon 15 that contains the repeatsDepositorInserthuman DMPK exons 11-15 with 0 CTG repeats (DMPK Human)
ExpressionMammalianAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
mCherry-cGAS-HA
Plasmid#231895PurposeExpression of cyclic GMP/AMP synthase (cGAS), as a nuclear rupture markerDepositorAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
DT480
Plasmid#80413PurposeExpresses 480 interrupted CUG repeats in the context of human DMPK genomic segment containing exons 11-15 with repeats inserted at site in exon 15 that contains the repeatsDepositorInserthuman DMPK exons 11-15 with 480 interrupted CTG repeats (DMPK Human)
ExpressionMammalianAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DT240
Plasmid#80414PurposeExpresses 240 interrupted CUG repeats in the context of human DMPK genomic segment containing exons 11-15 with repeats inserted at site in exon 15 that contains the repeatsDepositorInserthuman DMPK exons 11-15 with 240 interrupted CTG repeats (DMPK Human)
ExpressionMammalianAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DT40
Plasmid#80415PurposeExpresses 40 interrupted CUG repeats in the context of human DMPK genomic segment containing exons 11-15 with repeats inserted at site in exon 15 that contains the repeatsDepositorInserthuman DMPK exons 11-15 with 40 interrupted CTG repeats (DMPK Human)
ExpressionMammalianAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only