We narrowed to 22,657 results for: CRISPR
-
Plasmid#223424PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate ZmUbi1 promoter; BASTA for plants selection.DepositorInsertZmUbi-ecTadA8e-dLbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT53
Plasmid#223425PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-dLbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT54
Plasmid#223426PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate 2x35s promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-dLbCas12a-D156R-2x35s-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT31
Plasmid#223403PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for dicot plants; NGG PAM; SpCas9D10A-ABE was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-ecTadA8e-SpCas9-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT33
Plasmid#223405PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for dicot plants; NGG PAM; SpCas9D10A-ABE was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-SpCas9-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT34
Plasmid#223406PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT35
Plasmid#223407PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT36
Plasmid#223408PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT37
Plasmid#223409PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for dicot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by AtUBQ10 and the sgRNA was driven by AtU3; Hygromycin for plants selection.DepositorInsertAtUBQ10-ecTadA8e-SpRY-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT40
Plasmid#223412PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for monocot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpRY-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT43
Plasmid#223415PurposeT-DNA vector for temperature tolerance LbCas12a-D156R based mutagenesis for monocot plants; TTTV PAM; LbCas12a-D156R and the crRNA were driven by separate ZmUbi1 promoter; BASTA for plants selection.DepositorInsertZmUbi-LbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPR; T-dna vectorTagsNLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Nat-ADE2
Plasmid#232106PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRTagsExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Hyg-ADE2
Plasmid#232104PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRTagsExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterGAL7Available sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg-ADE2
Plasmid#232107PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRTagsExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
p223-Pulse-Switch
Plasmid#217889PurposeLentiviral Pulse-Switch vector for sgRNA expression, Cas9 and sgRNA expression are mutual exclusive; blastiRDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEL667
Plasmid#196815PurposeLrCas9 genome editing plasmid in wheatDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterZmUbiAvailable sinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL668
Plasmid#196816PurposeLrCas9 genome editing plasmid in larixDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterLrk004PAvailable sinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL669
Plasmid#196817PurposeLrCas9 genome editing plasmid in tomatoDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterSlEF1aAvailable sinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only