We narrowed to 16,445 results for: ache
-
Plasmid#106193PurposeMedium affinity glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-iGluSnFR.A184V
UseAAVTagsExpressionMutationGltI: A184VPromoterGFAPAvailable sinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFRT/TO/HIS/FLAG/HA-CSNK1E
Plasmid#38078DepositorInsertCSNK1E casein kinase 1, epsilon (CSNK1E Human)
UseTagsHIS/FLAG/HAExpressionMammalianMutationPromoterAvailable sinceSept. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBabe_puro_DEST_Flag_FNDC3B
Plasmid#45269DepositorInsertFNDC3B (FNDC3B Human)
UseRetroviralTagsFlagExpressionMammalianMutationPromoterAvailable sinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-GUS-OcsT
Plasmid#71267PurposeEntry clone containing the GUS enzyme. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertBeta-glucuronidase
UseGatewayTags2xGly linker and octaline synthase terminatorExpressionMutationPromoterAvailable sinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2 mCherry-Rtn4HD
Plasmid#86685PurposeLentivirus to stably express fluorescent human protein in mammalian cellsDepositorInsertRtn4 homology domain (RTN4 Human)
UseLentiviralTagsmCherryExpressionMammalianMutationhomology domain onlyPromoterCMVAvailable sinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
p-mCherry-C1-Aurora
Plasmid#98167Purposered-shifted artificial anion conducting channelrhodopsin (aACR). Activation up to 600 nm; off-kinetics 260 ms. Codon optimized for mammalian expression.DepositorInsertSynthetic construct Aurora gene
UseTagsmCherryExpressionMammalianMutationV59S, E83N, E90Q, E101S, V117R, E123S, P242R, A24…PromoterCMV (+enhancer)Available sinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.SF-iGluSnFR.S72A
Plasmid#106194PurposeWeak affinity glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-iGluSnFR.S72A
UseAAVTagsExpressionMutationGltI: S72APromoterGFAPAvailable sinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2 GFP-Rtn4HD
Plasmid#86686PurposeLentivirus to stably express fluorescent human protein in mammalian cellsDepositorInsertRtn4 homology domain (RTN4 Human)
UseLentiviralTagsGFPExpressionMammalianMutationhomology domain onlyPromoterCMVAvailable sinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(A)
Plasmid#85570PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
rgef-1p::NmBirA
Plasmid#79971Purposeencodes E.coli biotin-ligase under neuronal promotor for C.elegansDepositorInsertBirA
UseTagsNLS::mycExpressionWormMutationPromoterrgefAvailable sinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKK-NoTag
Plasmid#105767PurposeControl vector for pKK series (encodes only SLIC arms (TEV-L and TEV-R)); expression without tag. Useful to design other vectors; any tag can be added.DepositorTypeEmpty backboneUseFlp-in competentTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS511b
Plasmid#87387PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS511b sequence CAGTGTATGCCAGTCAGCCA in yeast chromosome 5.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS511b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(B)
Plasmid#85571PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
SIN-cPPT-H1-sgHTT1-U6-sgGFP2-7SK-sgCas9-PGK-mCherry-WPRE
Plasmid#87919PurposeHIV-1 SIN lentiviral transfer vectorDepositorInsertsgHTT1, shGFP2, sgCas9, cherry
UseLentiviralTagsExpressionMutationPromoterH1, U6, 7SK, PGKAvailable sinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKK-FLAG-TEV
Plasmid#105768PurposeExpression of your protein of interest in fusion with FLAG at the N-terminus. The tag is cleavable by TEV protease or enterokinase.DepositorTypeEmpty backboneUseFlp-in competentTagsFLAG-TEVExpressionMammalianMutationPromoterAvailable sinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only