We narrowed to 24,347 results for: c-MYC
-
Plasmid#32528DepositorAvailable SinceOct. 26, 2011AvailabilityAcademic Institutions and Nonprofits only
-
pTol2CG2-acta1:QFGal4-SV40pA
Plasmid#155121PurposeTol2 vector for skeletal-muscle expression of QFGal4. Contains cmlc2:mRFP-SV40pA transgenesis markerDepositorInsertacta1:QFGal4
UseZebrafish expressionPromoteracta1Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNS19-LV-mutRFP-2A-GFP
Plasmid#113716PurposeLentiviral vector for fluorescent reporter system: expresses a green fluorescent protein that is preceded by an inactive version of a red fluorescent protein (2 ntd substitution at the fluorophore)DepositorInsertmutRFP-2A-GFP-IRES-Puro
UseLentiviral; Reporter systemExpressionMammalianMutationY64L (mutRFP)Available SinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only