We narrowed to 4,329 results for: biorxiv
-
Plasmid#133791PurposeU6 promoter sgRNA entry vector used for all St1Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to V1 sgRNA architecture from Carter et al. biorxiv 2018DepositorInsertSt1Cas9 sgRNA entry vector
UseTagsExpressionMammalianMutationV1 sgRNA architecture from Carter et al. biorxiv …PromoterU6Available sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-PinkyCaMP
Plasmid#232860PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under CAG promoterDepositorInsertPinkyCaMP
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCF142_U6-sgRNA
Plasmid#225960PurposeU6-sgRNA (recipient). Expresses U6-sgRNA (recipient) for VLP production. This is a recipient vector for cloning of specific SpyCas9 sgRNAs.DepositorInsertU6-sgRNA (recipient)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF159_BRL
Plasmid#225962PurposeCMV-Intron-BRL (env protein). Expresses BRL (BaEVRLess) env for VLP production.DepositorInsertCMV-Intron-BRL (env protein)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-gfaABC1D-PinkyCaMP
Plasmid#232859PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under gfaABC1D promoterDepositorInsertPinkyCaMP
UseAAVTagsExpressionMammalianMutationPromotergfaABC1DAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCF153_Gag-Pol
Plasmid#225961PurposeCMV-Intron-GagPol (FMLV). Expresses FMLV (Friend Murine Leukemia Virus) Gag-Pol for VLP production.DepositorInsertCMV-Intron-GagPol (FMLV)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-PinkyCaMP
Plasmid#232858PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under CaMKII promoterDepositorInsertPinkyCaMP
UseAAVTagsExpressionMammalianMutationPromoterCaMKIIAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pN1-PinkyCaMP
Plasmid#232861PurposeA vector expressing the mScarlet based calcium indicator PinkyCaMP under CMV promoterDepositorInsertPinkyCaMP
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3G-PE2-P2A-BFP
Plasmid#231580PurposeExpresses the PE2 prime-editing machinery fused to BFP (PE2-P2A-BFP), under the control of a TRE3G promoter. This promoter is responsive to doxycycline bound to the rtTA proteinDepositorInsertPE2-P2A-BFP
UseLentiviralTagsP2A-BFPExpressionMammalianMutationPromoterTRE3GAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-PinkyCaMP
Plasmid#232856PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under hSyn promoterDepositorInsertPinkyCaMP
UseAAVTagsExpressionMammalianMutationPromoterhSynAvailable sinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1a-E1MLS-2xMyc-Ku-IRES-Hygro
Plasmid#234950PurposeHuman codon optimized Ku (Mycobacterium) with N-terminal E1 MLS expressing plasmidDepositorInserthuman codon optimized Ku with N-terminal mitochondrial localization signal of pyruvate dehydrogenase E1 subunit
UseLentiviralTagsMycExpressionMammalianMutationPromoterEF1aAvailable sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1a-E1MLS-2xFLAG-LigD-IRES-tdTomato
Plasmid#234951PurposeHuman codon optimized LigD (Mycobacterium) with N-terminal E1 MLS expressing plasmidDepositorInsertHuman codon optimized LigD with N-terminal mitochondrial localization signal of pyruvate dehydrogenase E1 subunit
UseLentiviralTagsFLAGExpressionMammalianMutationPromoterEF1AAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pORTMAGE311B
Plasmid#120418PurposeExpresses Lambda Beta and a dominant negative MutL E32K allele, controlled by XylS-Pm expression system for high precision and efficient MAGE experiments at 37°C. RSF1010 Ori; Broad host-range; KanRDepositorArticleInsertsMutL E32K
Lambda Beta
XylS
UseTagsExpressionBacterialMutationE32K mutation conferring dominant mutator phenoty…PromoterPmAvailable sinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
M13cp-dg3 hp
Plasmid#218095PurposeHelper plasmid that allows phagemid production upon complementation with a phagemid expressing pIIIDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBOB-CAG-SARS-CoV2-Spike-HA
Plasmid#141347Purpose3. Generation lentiviral vector expressing the codon optimized SARS-CoV2 Spike Glycoprotein ORF with a C-terminal HA tag generated by Junko Ogawa & Gerald M PaoDepositorInsertSARS-CoV2 Spike Glycoprotein (S SARS-CoV2 hCoV19_USA EPI_ISL_414366 (GISAID))
UseLentiviralTagsHAExpressionMutationresynthesized with human codon optimization nucle…PromoterCAGAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLIB_GST-TEV-SRC(WT)
Plasmid#223742PurposeExpression of recombinant protein for purification, codon optimized for Insect cellsDepositorInsertSrc Kinase (SRC Human)
UseTagsGST-TEVExpressionInsectMutationPromoterAvailable sinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiTet-LDLR-mCherry BlastR
Plasmid#186739PurposeDox inducible LDLR coding sequence expression construct cloned into a lentiviral backbone containing a blasticidin resistance geneDepositorInsertLDLR (LDLR Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBK2044-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2
Plasmid#223164Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable sinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLIB_GST-TEV-SRC (Y530F)
Plasmid#223743PurposeExpression of recombinant protein for purificationDepositorInsertSrc Kinase (SRC Human)
UseTagsGST-TEVExpressionInsectMutationY530F constitutively active mutantPromoterAvailable sinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only