We narrowed to 11,378 results for: actin
-
Plasmid#59924PurposeExpression vector for Rabies virus SAD B19 nucleoprotein geneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRabies virus nucleoprotein
ExpressionMammalianPromoterCAGAvailable sinceSept. 17, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pNW3
Plasmid#53372PurposeCsy4 and Cas9 D10A nickase expression plasmidDepositorInsertCsy4-T2A-Cas9n (D10A)
UseCRISPRExpressionMammalianPromoterCAGAvailable sinceJune 19, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pNW3
Plasmid#53372PurposeCsy4 and Cas9 D10A nickase expression plasmidDepositorInsertCsy4-T2A-Cas9n (D10A)
UseCRISPRExpressionMammalianPromoterCAGAvailable sinceJune 19, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAG-T3-hCasD10A-pA
Plasmid#51638PurposeExpresses Cas9-nickase in mammalian cells and zygotes.DepositorInsertCodon-optimized Cas9 D10A
UseCRISPRTagsFLAG, NLS, and polyAExpressionMammalianPromoterCAG promoterAvailable sinceMarch 14, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAG-T3-hCasD10A-pA
Plasmid#51638PurposeExpresses Cas9-nickase in mammalian cells and zygotes.DepositorInsertCodon-optimized Cas9 D10A
UseCRISPRTagsFLAG, NLS, and polyAExpressionMammalianPromoterCAG promoterAvailable sinceMarch 14, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
human TLNRD1-F250D pET151
Plasmid#159385PurposeExpresses human TLNRD1 F250D mutant in bacterial cellsDepositorInsertTalin Rod Domain Containing Protein 1 F250D mutant (TLNRD1 Human)
TagsHis-tag, TEV cleavage siteExpressionBacterialMutationChanged Phenylalanine 250 to Aspartic Acid (F250D)PromoterT7Available sinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTIGER_tdTomato::3xFLAG::dCrk
Plasmid#131138PurposeUASp construct for over-expression of Drosophila Crk with N-terminal tandem Tomato and 3X FLAG tag. Compatible with PhiC31-mediated site-specific integration or classical P-element insertion.DepositorAvailable sinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
human TLNRD1-F250D pET151
Plasmid#159385PurposeExpresses human TLNRD1 F250D mutant in bacterial cellsDepositorInsertTalin Rod Domain Containing Protein 1 F250D mutant (TLNRD1 Human)
TagsHis-tag, TEV cleavage siteExpressionBacterialMutationChanged Phenylalanine 250 to Aspartic Acid (F250D)PromoterT7Available sinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTIGER_tdTomato::3xFLAG::dCrk
Plasmid#131138PurposeUASp construct for over-expression of Drosophila Crk with N-terminal tandem Tomato and 3X FLAG tag. Compatible with PhiC31-mediated site-specific integration or classical P-element insertion.DepositorAvailable sinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CAG-GFP (AAV CAP-B10)
Viral prep#37825-CAP-B10PurposeReady-to-use AAV CAP-B10 particles produced from pAAV-CAG-GFP (#37825). In addition to the viral particles, you will also receive purified pAAV-CAG-GFP plasmid DNA. CAG-driven GFP expression. These AAV were produced with the CAP-B10 serotype, which permits efficient transduction of both inhibitory and excitatory neurons in the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFPAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
SECURE BE3(R33A/K34A)-P2A-EGFP (pJUL1410)
Plasmid#123615PurposeCAG promoter expression plasmid for rAPOBEC1(R33A/K34A)-XTEN-hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP (SECURE variant BE3-R33A/K34A).DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBE3(R33A/K34A)-P2A-EGFP
ExpressionMammalianMutationR33A/K34A in rAPOBEC1, D10A in SpCas9PromoterCAGAvailable sinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
SECURE BE3(R33A/K34A)-P2A-EGFP (pJUL1410)
Plasmid#123615PurposeCAG promoter expression plasmid for rAPOBEC1(R33A/K34A)-XTEN-hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP (SECURE variant BE3-R33A/K34A).DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBE3(R33A/K34A)-P2A-EGFP
ExpressionMammalianMutationR33A/K34A in rAPOBEC1, D10A in SpCas9PromoterCAGAvailable sinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS_VP35_EBOV
Plasmid#103050PurposeEncodes Ebola virus VP35 gene (Zaire ebolavirus, Mayinga) under control of the CAG promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertVP35 gene of Ebola virus (VP35 (Zaire ebolavirus, Mayinga))
ExpressionMammalianPromoterCAGAvailable sinceDec. 20, 2017AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pCAGGS_VP35_EBOV
Plasmid#103050PurposeEncodes Ebola virus VP35 gene (Zaire ebolavirus, Mayinga) under control of the CAG promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertVP35 gene of Ebola virus (VP35 (Zaire ebolavirus, Mayinga))
ExpressionMammalianPromoterCAGAvailable sinceDec. 20, 2017AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pF CAG luc-EGFP-cre puro
Plasmid#67503PurposeConstitutive expression of a firefly luciferase-enhanced green fluorescent protein-cre recombinase fusion protein in mammalian cellsDepositorInsertluciferase-EGFP-cre
UseCre/Lox, Lentiviral, and Luciferase ; Fluorescent…ExpressionMammalianPromoterCAGAvailable sinceFeb. 17, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pF CAG luc-EGFP-cre puro
Plasmid#67503PurposeConstitutive expression of a firefly luciferase-enhanced green fluorescent protein-cre recombinase fusion protein in mammalian cellsDepositorInsertluciferase-EGFP-cre
UseCre/Lox, Lentiviral, and Luciferase ; Fluorescent…ExpressionMammalianPromoterCAGAvailable sinceFeb. 17, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAG-PuroDTK.Neo
Plasmid#72307PurposePiggyBac Cassette contains puromycin and TK genesDepositorInsertPuromycin-DTK-neo
ExpressionBacterial and MammalianPromoterCAG promoterAvailable sinceFeb. 15, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAG-PuroDTK.Neo
Plasmid#72307PurposePiggyBac Cassette contains puromycin and TK genesDepositorInsertPuromycin-DTK-neo
ExpressionBacterial and MammalianPromoterCAG promoterAvailable sinceFeb. 15, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by