-
PurposeConstitutive expression of a firefly luciferase-enhanced green fluorescent protein-cre recombinase fusion protein in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67503 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepF MCS puro
- Backbone size w/o insert (bp) 10733
- Total vector size (bp) 14192
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox, Luciferase ; Fluorescent protein
-
Selectable markersPuromycin ; EFGP (FACS)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsLB broth
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameluciferase-EGFP-cre
-
SpeciesSynthetic; Firefly-Aequorea victoria (synthetic)-P1 bacteriophage
-
Insert Size (bp)3459
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GCAACGTGCTGGTTGTTGTG
- 3′ sequencing primer GGGGACTTTCCACACCCTAAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe firefly luciferase coding sequence was derived from pGL2-Basic. The EGFP-cre sequence was derived from pIGCN21 (NCI at Frederick).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pF CAG luc-EGFP-cre puro was a gift from Brett Stringer (Addgene plasmid # 67503 ; http://n2t.net/addgene:67503 ; RRID:Addgene_67503) -
For your References section:
A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma. Stringer BW, Day BW, D'Souza RCJ, Jamieson PR, Ensbey KS, Bruce ZC, Lim YC, Goasdoue K, Offenhauser C, Akgul S, Allan S, Robertson T, Lucas P, Tollesson G, Campbell S, Winter C, Do H, Dobrovic A, Inglis PL, Jeffree RL, Johns TG, Boyd AW. Sci Rep. 2019 Mar 20;9(1):4902. doi: 10.1038/s41598-019-41277-z. 10.1038/s41598-019-41277-z PubMed 30894629