pF CAG luc-EGFP-cre puro
(Plasmid #67503)

• Purpose: Constitutive expression of a firefly luciferase-enhanced green fluorescent protein-cre recombinase fusion protein in mammalian cells
• Depositing Lab: Brett Stringer
• Publication: Stringer et al Sci Rep. 2019 Mar 20;9(1):4902. doi: 10.1038/s41598-019-41277-z.

Backbone

• Vector backbone: pF MCS puro
• Backbone size w/o insert (bp): 10733
• Total vector size (bp): 14192
• Vector type: Mammalian Expression, Lentiviral, Cre/Lox, Luciferase ; Fluorescent protein
• Selectable markers: Puromycin ; EFGP (FACS)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: LB broth
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: luciferase-EGFP-cre
• Species: Synthetic; Firefly-Aequorea victoria (synthetic)-P1 bacteriophage
• Insert Size (bp): 3459
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: GCAACGTGCTGGTTGTTGTG
• 3′ sequencing primer: GGGGACTTTCCACACCCTAAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The firefly luciferase coding sequence was derived from pGL2-Basic. The EGFP-cre sequence was derived from pIGCN21 (NCI at Frederick).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry