Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pF CAG luc-EGFP-cre puro
(Plasmid #67503)


Item Catalog # Description Quantity Price (USD)
Plasmid 67503 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pF MCS puro
  • Backbone size w/o insert (bp) 10733
  • Total vector size (bp) 14192
  • Vector type
    Mammalian Expression, Lentiviral, Cre/Lox, Luciferase ; Fluorescent protein
  • Selectable markers
    Puromycin ; EFGP (FACS)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    LB broth
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    Synthetic; Firefly-Aequorea victoria (synthetic)-P1 bacteriophage
  • Insert Size (bp)
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GCAACGTGCTGGTTGTTGTG
  • 3′ sequencing primer GGGGACTTTCCACACCCTAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The firefly luciferase coding sequence was derived from pGL2-Basic. The EGFP-cre sequence was derived from pIGCN21 (NCI at Frederick).

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pF CAG luc-EGFP-cre puro was a gift from Brett Stringer (Addgene plasmid # 67503 ; ; RRID:Addgene_67503)
  • For your References section:

    A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma. Stringer BW, Day BW, D'Souza RCJ, Jamieson PR, Ensbey KS, Bruce ZC, Lim YC, Goasdoue K, Offenhauser C, Akgul S, Allan S, Robertson T, Lucas P, Tollesson G, Campbell S, Winter C, Do H, Dobrovic A, Inglis PL, Jeffree RL, Johns TG, Boyd AW. Sci Rep. 2019 Mar 20;9(1):4902. doi: 10.1038/s41598-019-41277-z. 10.1038/s41598-019-41277-z PubMed 30894629