We narrowed to 10,667 results for: plasmids 101
-
Plasmid#73572PurposeMammalian retroviral expression of Atoh1DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only
-
YAF2_pLX307
Plasmid#98383PurposeLentiviral expression of YAF2DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
-
pAAV-U6-DR30(SapI)-CMV-intron-MCS-pA
Plasmid#192496PurposeTo express CasRX gRNA and contains MCS to insert coding region of interestDepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-DjCas13d-P2A-mCherry-pA
Plasmid#233027PurposeTo Express HA tagged DjCas13d and mcherry from the mammalian EFS promoter. The DjCas13dx and mCherry are separated by a P2A siteDepositorInsertDjCas13d/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-P2A-mCherry-pA
Plasmid#233025PurposeTo Express HA tagged CasRX and mcherry from the mammalian EFS promoter. The CasRx and mCherry are separated by a P2A siteDepositorInsertCasRx/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-hfCas13d-P2A-mCherry-pA
Plasmid#233026PurposeTo Express HA Tagged hfCas13d and mcherry from the mammalian EFS promoter. The hfCas13d and mCherry are separated by a P2A siteDepositorInserthfCas13d/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
-
pAAV-U6-DR30(SapI) 0.5 Syn-intron-hfCas13d-pA
Plasmid#233039PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged hfCas13d from a 0.5 bp synapsin promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and hfCas13d
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA/EF1a-mCherry-WPRE-pa
Plasmid#233034PurposeTo Express HA tagged hfCas13d the CMV promoter. Also encodes a mCherry gene outside of the viral genomeDepositorInserthfCas13d and mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DjCas13d-pA/EF1a-mCherry-WPRE-pa
Plasmid#233033PurposeTo Express HA tagged DjCas13d the CMV promoter. Also encodes a mCherry gene outside of the viral genomeDepositorInsertDjCas13d and mCherry
UseAAVTagsmCherryAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pscAAV-CAG-RLuc
Plasmid#83280Purposerecombinant AAV vector packaging self-complementary Renilla Luciferase under the CAG promoterDepositorInsertRenilla Luciferase
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMXs-M2O
Plasmid#188034PurposeFusion of human MYC Transactivation Domain (TAD) MYC Box I/II (MBI/II) with human OCT4 protein expressed in pMXs vectorDepositorAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
hSyn-HA-PGRN-IRES2-GFP
Plasmid#234876PurposeLentiviral plasmid expressing HA-tagged human progranulin followed by IRES2-GFP.DepositorAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI) 0.5 Syn-intron-CasRx-pA
Plasmid#233038PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged CasRx from a 0.5 bp synapsin promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and CasRx
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-CasRx-pA/EF1a-mCherry-WPRE-pa
Plasmid#233032PurposeTo Express HA tagged CasRX the CMV promoter. Also encodes a mCherry gene outside of the viral genomeDepositorInsertCasRx and mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only