We narrowed to 5,002 results for: lenti sgrna
-
Plasmid#194284PurposeEF1a-dCas9-KRAB-GFP with nontarget sgRNADepositorInsertdCas9-KRAB-GFP
UseCRISPR and LentiviralTagsGFPPromoterEF1aAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
LV-U6-sgRNAfiller-PGK-Cre-EFS-mScarletSIIN
Plasmid#172436PurposeLentivirus, expresses Cre recombinase and mScarlet-SIINFEKL, with sgRNA cloning siteDepositorInsertsCre
mScarlet-SIINFEKL(OVA257-264)+Ova 323-339
UseCRISPR and LentiviralAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX-sgRNA-BfuAI-2k
Plasmid#112915PurposeEmpty sgRNA expression plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceSept. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-sgRNA-com-BoxB-vector
Plasmid#132556PurposeExpresses dCas9-DMNT3a-DMNT3l fusion protein, lambda N22-KRAB fusion protein, and sgRNA scaffold with com and BoxB replacing the Tetraloop and the loop 2 respectively.DepositorInsertsdCas9-DMNT3a-DMNT3l (DNMT3A Synthetic)
Lambda N22-KRAB
sgRNA acaffold with com and BoxB replacing the Tetraloop and the loop 2.
ExpressionMammalianAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pL-U6-sgRNA-SFFV-Puro-P2A-EGFP
Plasmid#175037PurposeLentiviral delivery of sgRNA. Expresses PuroR and eGFP from SFFV promoter.DepositorInsertSp sgRNA scaffold
UseLentiviralPromoterU6Available SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSaCas9-sgRNA-Tetra-com vector
Plasmid#131227PurposeFor expressing gRNA, whose Tetraloop is replaced with a com aptamerDepositorInsertvector for com modified sgRNA
UseAAVExpressionMammalianAvailable SinceOct. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA1-2XMS2
Plasmid#75389PurposesgRNA1-2XMS2DepositorInsertsgRNA1-2XMS2
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterU6Available SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA1-2XPP7
Plasmid#75390PurposesgRNA1-2XPP7DepositorInsertsgRNA1-2XPP7
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterU6Available SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA1-2XboxB
Plasmid#75391PurposesgRNA1-2XboxBDepositorInsertsgRNA1-2XboxB
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterU6Available SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV_hU6-sgRNA_hUbC-GFP-P2A-PuroR
Plasmid#162335PurposeLentiviral expression of S. pyogenes sgRNA with a GFP-P2A-PuroR selection markerDepositorInsertS. pyogenes sgRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-ABE-3'UTR-sgRNA-2xMS2
Plasmid#132554PurposeVector plasmid expressing ABEmax and sgRNA scaffold with MS2 replacing the Tetraloop and loop 2DepositorInsertsABEmax
sgRNA, with Tetraloop and loop 2 replaced by MS2 aptamer
ExpressionMammalianAvailable SinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
U6-Slc1a3 sgRNA; EF1a-dCas9-KRAB-GFP
Plasmid#194283PurposeEF1a-dCas9-KRAB-GFP with Slc1a3 sgRNADepositorInsertdCas9-KRAB-GFP
UseCRISPR and LentiviralTagsGFPPromoterEF1aAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.FOXA-ZEB2_CRISPRd
Plasmid#216170PurposeExpress the gRNA targeting the FOXA-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- FOXA.bs- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.Control-ZEB2_CRISPRd
Plasmid#216172PurposeExpress the gRNA targeting the control site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- Control- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.PRDM1-ZEB2_CRISPRd
Plasmid#216171PurposeExpress the gRNA targeting the PRDM1-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PLOD2 sgRNA4
Plasmid#136459PurposeExpression of gRNA against human PLOD2DepositorInsertgRNA against human PLOD2 (PLOD2 Synthetic, Human)
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PLOD2 sgRNA3
Plasmid#136458PurposeExpression of gRNA against human PLOD2DepositorInsertgRNA against human PLOD2 (PLOD2 Synthetic, Human)
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PLOD2 sgRNA5
Plasmid#136460PurposeExpression of gRNA against human PLOD2DepositorInsertgRNA against human PLOD2 (PLOD2 Synthetic, Human)
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only