We narrowed to 296,206 results for: Gene
-
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1TGt
Plasmid#44508DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSB65 - pL0_tGFP-I (CDS1)
Plasmid#123182PurposeGolden Gate (MoClo; CDS1) compatible turbo GFP gene from P. plumata with an intron for transient and stable expression in plants (moved to a CDS1 position from pICSL50016; Engler et al., 2014)DepositorInsertturboGFP codon-optimised for plants (P. plumata) with intron, U5 small nuclear ribonucleoprotein component (A. thaliana)
UsePart for plant expressionExpressionPlantMutationNo BpiI and BsaI sites; codon-optimised for plantsAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-0.66kb-EGFP
Plasmid#153165PurposeTruncated mouse gamma-synuclein (mSncg-0.66kb) promoter-mediates gene expression in retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDN-T1TCbt
Plasmid#44514DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationThree tandem tet operators (3XtetO2) downstream o…PromoterPGal1-T123 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-1.03kb-EGFP
Plasmid#153164PurposeTruncated mouse gamma-synuclein (mSncg-1.03kb) promoter-mediates gene expression in mammalian retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1TCbt
Plasmid#44515DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL537
Plasmid#49945PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL536
Plasmid#49942PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL534
Plasmid#49940PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
PB-iRFP-STOP-ReNL
Plasmid#113965PurposePiggybac transposon plasmid CRISPR gene deletion activatable fluorescence. Constitutive iRFP670 under EF1A promoter, CMV promoter with two SV40 polyA followed by red-enhanced nanolantern (ReNL)DepositorInsertsiRFP670
ReNL
UsePiggybac transposonExpressionMammalianPromoterCMV - SV40-PolyA - SV40-PolyA and EF1AAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
SL535
Plasmid#49941PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only