We narrowed to 28,407 results for: cmv promoter
-
Plasmid#133795PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA1 with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA1
TagsNLS(SV40)ExpressionMammalianMutationn/aPromoterCMV and T7Available SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMCh1753_S2F-IMCg_doxy-CMV_mChe-Cdc42E7-E63'UTR
Plasmid#118615Purposeexpression of mChe-tagged cdc42E7-E6-3'UTR (swap) under doxy-inducible CMV promoterDepositorInsertcdc42E7-E6 3'UTR (Cdc42 Mouse)
UseLentiviralTagsmCherryExpressionMammalianPromotertetON CMVAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (Y1467F)
Plasmid#61362Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inavtivating mutation Y1467F) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 Human, S. pyogenes, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; Y1467F mutation i…PromoterCMVAvailable SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
Control click editor - pCMV-T7-PCV2-deadCas9-EcKlenow (EMK500)
Plasmid#208944PurposeA control CE1 construct with catalytically inactivated SpCas9, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-dSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationdSpCas9(D10A/H840A);EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Control click editor - pCMV-T7-deadPCV2-nCas9-EcKlenow (EMK492)
Plasmid#208943PurposeA control CE1 construct with catalytically attenuated PCV2 HUH, expressed from CMV or T7 promoters.DepositorInsertdPCV2-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationPCV2(Y96F); nSpCas9(H840A); EcKlenow(-exo;D355A/E…PromoterCMV and T7Available SinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tc1-5_Xt
Plasmid#217132PurposeMammalian expression vector for expression of Tc1-5_Xt transposase (CMV promoter)DepositorInsertTc1-5_Xt transposase
ExpressionMammalianAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-hAT-7_PM
Plasmid#217147PurposeMammalian expression vector for expression of hAT-7_PM transposase (CMV promoter)DepositorInserthAT-7_PM transposase
ExpressionMammalianAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tc1-8B_DR
Plasmid#217117PurposeMammalian expression vector for expression of Tc1-8B_DR transposase (CMV promoter)DepositorInsertTc1-8B_DR transposase
ExpressionMammalianAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/FRT-ChemoG-NAD
Plasmid#193821PurposeCMV overexpression of ChemoG-NAD in mammalian cell linesDepositorInsertChemoG-NAD
ExpressionMammalianMutationEGFP:A206K, T225R; HT7: L271EPromoterCMVAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/FRT/TO_CalR-HaloTag7-P30-SNAP-tag-KDEL
Plasmid#182012PurposeCMV overexpression of HaloTag7 and SNAP-tag fusion in the endoplasmic reticulum of mammalian cell linesDepositorInsertCalR-HaloTag7-P30-SNAP-tag-KDEL
ExpressionMammalianPromoterCMVAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMAL
Plasmid#161783PurposeGateway destination vector with bidirectional CMV-PGK promoter for modest expression of gene of interest and GFP.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterBidirectional minhCMV and hPGKAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
psgRNA-GST-EGFP-GPIBY55
Plasmid#213720PurposeTo express a single-guide RNA under a U6 promoter, accompanied by the expression of the affinity sorting tag GST-EGFP-GPIBY55 under a CMV promoter.DepositorInsertEGFP
UseCRISPRTagsGSTPromoterCMVAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
psgRNA-GST-EGFP-GPICEAM7
Plasmid#213721PurposeTo express a single-guide RNA under a U6 promoter, accompanied by the expression of the affinity sorting tag GST-EGFP-GPICEAM7 under a CMV promoter.DepositorInsertEGFP
UseCRISPRTagsGSTPromoterCMVAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.CMVs.Pl.Cre.rBG (AAV rh10)
Viral Prep#105537-rh10PurposeReady-to-use AAV rh10 (similar to AAV10) particles produced from pENN.AAV.CMVs.Pl.Cre.rBG (#105537). In addition to the viral particles, you will also receive purified pENN.AAV.CMVs.Pl.Cre.rBG plasmid DNA. CMV-driven Cre. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCMVAvailable SinceJuly 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pN3-mTagBFP-pHluorin-CAAX
Plasmid#178345PurposeExpress a pH insensitive blue fluorencent protein mTagBFP fused to the N-terminal of a membrane targeted pH sensitive green fluorescent protein pHluorin-CAAX under CMV promoterDepositorInsertmTagBFP-pHluorin-CAAX
ExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cx43-sfGFP
Plasmid#70053PurposeExpresses rat Cx43 (Gja1 CDS) tagged with non-monomerized sfGFP on the C-terminus. CMV promoter.DepositorInsertCx43 (Gja1 Rat)
Tagsnon-monomerized superfolder GFP (V207)Mutationfused in frame to non-monomerized superfolder GFPPromoterCMVAvailable SinceOct. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-NMHC-IIA-3xA
Plasmid#101041PurposeExpresses GFP-MYH9 construct (human myosin IIA) carrying S1943A mutation and S1916A, S1915A mutation, driven by CMV promoter. Thus inhibits CKII and PKC phosphorylation of the tail.DepositorInsertNon-muscle myosin IIA heavy chain (MYH9 Human)
TagsGFPExpressionMammalianMutationS1915A, S1916A, S1943APromoterCMVAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCB268
Plasmid#53363PurposepcDNA3.0-based plasmid encoding fDHFR-UbK48R-Aβ42 13myc under the control of T7 or CMV promoter for 35S-pulse-chase URT-based assays in rabbit reticulocyte extract.DepositorTags13xMyc, Flag, and HAExpressionMammalianPromoterCMVAvailable SinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only