We narrowed to 4,502 results for: erf
-
-
-
-
AAVS1_dCas9-XTEN-KRAB-p2A-GFP
Plasmid#222108PurposeDonor vector for CRISPRi integration at AAVS1 with a GFP fluorophoreDepositorInsertCRISPRi-kox1(KRAB) (cas9 S. pyogenes, Human)
UseAAV and CRISPRTagsHA and P2A-GFPExpressionMammalianMutationD10A, H840AAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF149 shRNA-TRE
Plasmid#225337PurposeshRNAmir backbone under tet-operator for RNA interference, with YFPDepositorInsertRNF149 shRNA (Rnf149 Mouse)
UseAAV and RNAiExpressionMammalianPromoterTRE (tetracycline-responsive element)Available SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
USP7 shRNA-TRE
Plasmid#225338PurposeshRNAmir backbone under tet-operator for RNA interference, with YFPDepositorInsertUSP7 shRNA (Usp7 Mouse)
UseAAV and RNAiExpressionMammalianPromoterTRE (tetracycline-responsive element)Available SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
Luciferase shRNA-TRE
Plasmid#225339PurposeshRNAmir backbone under tet-operator for RNA interference, with YFPDepositorInsertLuciferase shRNA (LOC116160065 Mouse)
UseAAV and RNAiExpressionMammalianPromoterTRE (tetracycline-responsive element)Available SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBS-856
Plasmid#218014PurposesfGFP fluorescent proteinDepositorInsertsfGFP
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
GL4.10 E2E1- Prg4 promoter-luciferase
Plasmid#195035PurposePrg4 enhancer/promoterfirefly luciferase constructs were constructed by cloning various Prg4 regulatory fragments into pGL4.10[luc2] vectorDepositorInsertPrg4 promoter plus Enhancer 1 and Enhancer 2 (PRG4 Bovine)
UseLuciferaseAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.10 E3E2E1-Prg4 promoter-luciferase
Plasmid#195036PurposePrg4 enhancer/promoterfirefly luciferase constructs were constructed by cloning various Prg4 regulatory fragments into pGL4.10[luc2] vectorDepositorInsertPrg4 promoter plus Enhancer 1, Enhancer 2, and Enhancer 3 (PRG4 Bovine)
UseLuciferaseAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.10 E4E3E2E1-Prg4 promoter-luciferase
Plasmid#195037PurposePrg4 enhancer/promoterfirefly luciferase constructs were constructed by cloning various Prg4 regulatory fragments into pGL4.10[luc2] vectorDepositorInsertpGL4.10 E4E3E2E1-Prg4 promoter-luciferase (PRG4 Bovine)
UseLuciferaseAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJL1-sfGFP-MOORmut
Plasmid#198213PurposepJL1 plasmid encoding superfolder GFP modified at the C-terminus with 32 amino acids containing a non-permissible minimum optimal O-linked recognition site (MOORmut) followed by a 6x-His tagDepositorInsertsfGFP_MOORmut
Tags6x His Tag and mutated (non-permissible) MOORmut …ExpressionBacterialPromoterT7Available SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_CAHS1_PARRC_150-189 (pBS0658)
Plasmid#185201PurposeFor the mammalian expression of the tardigrade protein CAHS1_PARRC_150-189. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertCAHS1_PARRC_150-189
ExpressionMammalianAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_APOE_HUMAN_A234G (pBS0816)
Plasmid#185267PurposeFor the mammalian expression of the human protein APOE_HUMAN_A234G. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAPOE_HUMAN_A234G
ExpressionMammalianMutationA234GAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_D4NWF2_DrHD_b03_dom3 (pBS0681)
Plasmid#185207PurposeFor the mammalian expression of the Deinococcus radiodurans protein D4NWF2_DrHD_b03_dom3. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertD4NWF2_DrHD_b03_dom3
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_AfLEA1.1 (pBS0741)
Plasmid#185233PurposeFor the mammalian expression of the brine shrimp protein AfLEA1.1. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAfLEA1.1
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_Q19228_CAEEL_51-88 (pBS0734)
Plasmid#185230PurposeFor the mammalian expression of the C. elegans protein Q19228_CAEEL_51-88. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertQ19228_CAEEL_51-88
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_shuffle_5 (pBS0731)
Plasmid#185228PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_shuffle_5. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertpvLEA22mer_shuffle_5
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_shuffle_3 (pBS0729)
Plasmid#185227PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_shuffle_3. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertpvLEA22mer_shuffle_3
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only