We narrowed to 11,112 results for: nar;
-
Plasmid#206253PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes H2B iRFP713 under the control of CMV promoter. CRE-Acceptor in MultiBac system.DepositorInsertH2B iRFP713
UseRecombinant baculovirus production, multimate/gat…TagsiRFP713ExpressionMammalianMutationPromoterAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 2 CMV mKO2-hCdt1
Plasmid#206282PurposeENTR Vector 2 for MultiSite Gateway assembly. Encodes mKO2-hCdt1 under the control of CMVDepositorInsertmKO2-hCdt1 (CDT1 Human)
UseMultimate/gateway entr 2TagsExpressionMammalianMutationPromoterAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL452(hygro)-Sf3b1-K700K
Plasmid#90426Purposeselectable HDR vector to introduce silent mutation (position 700) in mus Sf3b1 gene (for use with pL452-Sf3b1-K700E and sgSf3b1(T1) gRNA vectors enabling generation of hemizygous K700E mutation)DepositorInsertSf3b1 - left and right homology arms (Sf3b1 Mouse)
UseHomology-directed repair vectorTagsExpressionMutationPromoterAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEPT_Cdk2-T160A-siR
Plasmid#73975PurposeHDR template to generate Cdk2-T160A-siRDepositorUseAAVTagsExpressionMutationT160 mutated to Ala and siRNA target site mutatedPromoterAvailable sinceMarch 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFl Strep-sumo-TEV-hAgo2 D597N
Plasmid#136236PurposeExpressing catalytically inactive human Argonaute-2 in insect cellsDepositorInserthuman Argonaute-2 (AGO2 Human)
UseTagsSterp SumoExpressionInsectMutationD597NPromoterpolyhedrinAvailable sinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTE4889
Plasmid#88905PurposeExpresses FnCpf1 crRNA and inactive/dead, humanized FnCpf1 nucleaseDepositorInsertsFn crRNA
hFnCpf1(D917A)
UseCRISPRTags3xHA and NLSExpressionMammalianMutationPromoterCMV and human U6Available sinceApril 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMMACE DEST CMV SpCas9
Plasmid#206268PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes SpCas9 under the control of CMV promoter. CRE-Acceptor in MultiBac system.DepositorInsertSpCas9
UseCRISPR; Recombinant baculovirus productionTagsExpressionMammalianMutationPromoterAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
JI501: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 gRNA scaffold
Plasmid#121841PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; empty hU6-driven SaCas9 gRNA scaffold for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to dCas9 w/ gRNA expressionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTE4566
Plasmid#88904PurposeExpresses MbCpf1 crRNA and inactive/dead, humanized MbCpf1 nucleaseDepositorInsertsMb crRNA
hMbCpf1(D986A)
UseCRISPRTags3xHA and NLSExpressionMammalianMutationPromoterCMV and human U6Available sinceApril 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau7-12WT
Plasmid#194166PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by the wild-type tau cDNA exons 7,9-12. Expresses the tau circRNA 12-->7 WT with 3X flag tag in exon 7.DepositorInsertMicrotubule-associated protein tau 7-12 WT
UseTags3X FlagExpressionMammalianMutationPromoterAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau10-12WT
Plasmid#194163PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by the wild-type tau cDNA exons 10-12. Expresses the tau circRNA 12-->10 WT with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 WT ZKSCAN1 intronic alu elements
UseTags3X flag tagExpressionMammalianMutationPromoterAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
KK701: pMAGIC (L3-L2) 3x HA eptitope tag + polyA; hU6::xCas9(3.7) gRNA scaffold
Plasmid#121842PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; empty hU6-driven xCas9(3.7) gRNA scaffold for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA fusion to dCas9 w/ gRNA expressionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgSf3b1(T1)
Plasmid#90424Purposeinduces dsDNA break within mouse Sf3b1 gene for subsequent homology-directed recombination and coding sequence mutagenesis at codon 700DepositorInsertmus Sf3b1 gRNA (Sf3b1 Mouse)
UseCRISPR; Guiderna encoding for gene editingTagsExpressionMammalianMutationPromoterU6Available sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE3328
Plasmid#107539PurposeExpresses As crRNA and human codon optimized AsCpf1(RR mutant) in mammalian cells.DepositorInsertsAs crRNA
hAsCpf1(RR mutant)
UseTags3xHA, NLS, and SV40 NLSExpressionMammalianMutationS542R, K607RPromoterCMV and human U6Available sinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTE3329
Plasmid#107538PurposeExpresses Lb crRNA and human codon optimized LbCpf1(RR mutant) in mammalian cells.DepositorInsertsLb crRNA
hLbCpf1(RR mutant)
UseTags3xHA, NLS, and SV40 NLSExpressionMammalianMutationG532R, K595RPromoterCMV and human U6Available sinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE3327
Plasmid#107535PurposeExpresses As crRNA and human codon optimized AsCpf1(RVR mutant) in mammalian cells.DepositorInsertsAs crRNA
hAsCpf1(RVR mutant)
UseTags3xHA, NLS, and SV40 NLSExpressionMammalianMutationS542R, K548V, N552RPromoterCMV and human U6Available sinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
KA801: pMVP (L3-L2) HA tag + pA; CMV::eGFP-P2A-TETa-pA
Plasmid#121800PurposepMVP L3-L2 entry plasmid, contains HA tag-polyA + CMV-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds C-term HA tag to gene plus downstream CMV-driven GFP-P2A-TETaDepositorInsertHA epitope tag-polyA + CMV::eGFP-P2A-TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTE3334
Plasmid#107537PurposeExpresses Mb crRNA and human codon optimized MbCpf1(RVR mutant) in mammalian cells.DepositorInsertsMb crRNA
hMbCpf1(RVR mutant)
UseTags3xHA and NLSExpressionMammalianMutationN576R, K582V, N586RPromoterCMV and human U6Available sinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE3330
Plasmid#107534PurposeExpresses Lb crRNA and human codon optimized LbCpf1(RVR mutant) in mammalian cells.DepositorInsertsLb crRNA
hLbCpf1(RVR mutant)
UseTags3xHA and NLSExpressionMammalianMutationG532R, K538V, Y542RPromoterCMV and human U6Available sinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only