We narrowed to 10,309 results for: yeast
-
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415 GPDpro-RNQ1-CFP
Plasmid#224887PurposeLow copy plasmid for constitutive yeast expression of RNQ1 tagged with CFP using copper. This is construct can be used as an IPOD marker (Kaganovich et al., 2008).DepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
p416-GPD-HA-PPK(mutant)
Plasmid#183944PurposeExpresses HA-tagged catalytic mutant of E. coli PPK from yeast GPD promoterDepositorInsertPPK(mutant) (ppk E. coli)
TagsHAExpressionYeastMutationmutations in His435, His454, and His592 to AlaninePromoterGPDAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_MET16
Plasmid#166091PurposePlasmid for constituive spCas9 and tet-inducible MET16 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceMay 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_CPR1_1
Plasmid#166074PurposePlasmid for constituive spCas9 and tet-inducible CPR1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RRT8
Plasmid#166080PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RRT8 for double stranded break formation in yeast.DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_CPR1_2
Plasmid#166071PurposePlasmid for constituive spCas9 expression and tet-inducible expression of an sgRNA targeting an intergenic site near CPR1 for double stranded break formation in yeast.DepositorInsertIntergenic region near CPR1
UseCRISPRExpressionYeastPromoterTet-inducibleAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_GAL7
Plasmid#166089PurposePlasmid for constituive spCas9 and tet-inducible GAL7 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_GLK1
Plasmid#166090PurposePlasmid for constituive spCas9 and tet-inducible GLK1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_LHS1
Plasmid#166092PurposePlasmid for constituive spCas9 and tet-inducible LHS1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only