We narrowed to 2,348 results for: Ott
-
Plasmid#188539PurposeAn AAV packaging vector that expresses secreted C-CDNF under control of the EGFP promoter.DepositorInsertsecreted EGFP
UseAAVTagsCDNF(1-28) and THPKTEL WPREPromoterCMV-IEAvailable sinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pVH270-Tier1-OTtgO2-PCMVmin2-SEAP-p2A-iRFP670
Plasmid#169592PurposeTier-1 vector encoding PTtgO2-driven SEAP-p2A-iRFP670 expression (OTtgO2-PCMVmin-2-SEAP-p2A-iRFP670-pA).DepositorInsertphloretin-controlled SEAP and iRFP expression
ExpressionMammalianPromoterTtgO2-PCMVmin-2Available sinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHL-EF1a-SphcCas9-iP-A
Plasmid#60599PurposeExpresses human codon-optimized Cas9 (derived from Streptococcus pyogenes) and pruomycin resistance gene.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCRISPR Cas9
UseCRISPRExpressionMammalianMutationCodon usage optimized for human usageAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHL-EF1a-SphcCas9-iP-A
Plasmid#60599PurposeExpresses human codon-optimized Cas9 (derived from Streptococcus pyogenes) and pruomycin resistance gene.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCRISPR Cas9
UseCRISPRExpressionMammalianMutationCodon usage optimized for human usageAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
eGFP-proα2(I)
Plasmid#119826PurposeExpresses mouse Type I procollagen α2 chain (Col1a2) with GFP between signal sequence and exon 6DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertType I procollagen α2 chain (Col1a2 Mouse)
TagseGFPExpressionMammalianMutationCol1a2 exons 2-5 replaced by fluorescent tagPromoterCMVAvailable sinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pOTTC2185 - pAAV nEF ConFoff hChR2(H134R)-mCherry
Plasmid#202546PurposeAn INTRSECT-ready adeno-associated viral vector expressing channelrhodopsin2-mCherry fusion (Cre-On and Flp-Off)DepositorInserthChR2(H134R)-mCherry
UseAAVPromoternEFAvailable sinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pOTTC2186 - pAAV nEF CoffFon hChR2(H134R)-mCherry
Plasmid#202547PurposeAn INTRSECT-ready adeno-associated viral vector expressing channelrhodopsin2-mCherry fusion (Cre-Off and Flp-On)DepositorInserthChR2(H134R)-mCherry
UseAAVPromoternEFAvailable sinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pOTTC2147 - pAAV nEF ConFon hChR2(H134R)-mCherry
Plasmid#202545PurposeAn INTRSECT-ready adeno-associated viral vector expressing channelrhodopsin2-mCherry fusion (Cre-On and Flp-On)DepositorInserthChR2(H134R)-mCherry
UseAAVPromoternEFAvailable sinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1845 - pAAV CaMKII hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201822PurposeAn adeno-associated viral vector expressing channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a CaMKii promoter, for use in PET imagingDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVPromoterCaMKiiAvailable sinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1664 - pAAV SYN1 mGas6(delta)-Myc-DDK
Plasmid#202541PurposeAn adeno-associated viral vector expressing murine Gas6 with deletion of (F50-E275) fused Myc and DDK epitopes from a synapsin promoterDepositorAvailable sinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1584 - pscAAV CMV-IE secreted EGFP-THPKTEL WPRE
Plasmid#188539PurposeAn AAV packaging vector that expresses secreted C-CDNF under control of the EGFP promoter.DepositorInsertsecreted EGFP
UseAAVTagsCDNF(1-28) and THPKTEL WPREPromoterCMV-IEAvailable sinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pVH270-Tier1-OTtgO2-PCMVmin2-SEAP-p2A-iRFP670
Plasmid#169592PurposeTier-1 vector encoding PTtgO2-driven SEAP-p2A-iRFP670 expression (OTtgO2-PCMVmin-2-SEAP-p2A-iRFP670-pA).DepositorInsertphloretin-controlled SEAP and iRFP expression
ExpressionMammalianPromoterTtgO2-PCMVmin-2Available sinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
eGFP-proα2(I)
Plasmid#119826PurposeExpresses mouse Type I procollagen α2 chain (Col1a2) with GFP between signal sequence and exon 6DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertType I procollagen α2 chain (Col1a2 Mouse)
TagseGFPExpressionMammalianMutationCol1a2 exons 2-5 replaced by fluorescent tagPromoterCMVAvailable sinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
xlox(GFP)hTERT
Plasmid#69809PurposeMLV retroviral vector expressing the hTERT reverse transcriptase immortalizing gene and a GFP markerDepositorAvailable sinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
xlox(GFP)hTERT
Plasmid#69809PurposeMLV retroviral vector expressing the hTERT reverse transcriptase immortalizing gene and a GFP markerDepositorAvailable sinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Luc-noPS
Plasmid#177940PurposeTransient mammalian expression of Luc2 (firefly luciferase). Lacks packaging sequence and is used as a negative control transfer plasmid for SARS-CoV-2 virus-like particles.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLuc2
ExpressionMammalianAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
xlox dNGFR-TERT
Plasmid#69805PurposeMLV retroviral vector expressing the hTERT reverse transcriptase immortalizing gene and a tNGFR marker for trackingDepositorAvailable sinceNov. 3, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pOTTC1822 - pAAV SYN1 DIO hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201821PurposeAn adeno-associated viral vector expressing Cre-dependent channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a synapsin promoter, for use in PETDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVPromoterSYN1Available sinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1535 pscAAV mU6 shRNA(scram) CMV-IE Nuc-EYFP
Plasmid#135563PurposeAn AAV vector expressing scrambled shRNA and a nuclear EYFP reporterDepositorInsertsshRNA (scrambled)
Nuc-EYFP
UseAAV and RNAiTags3xNLSExpressionMammalianPromoterCMV-IE and mU6Available sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only