We narrowed to 11,399 results for: nar
-
Plasmid#159086PurposeExpresses dCas9-P2A-EGFP driven by human SYN promoter and empty CRISPR Display sgRNA/accessory RNA from U6 promoter.DepositorInsertempty crRNA-acRNA backbone, dCas9-P2A-EGFP
UseCRISPR and LentiviralTagsEGFP and FLAGExpressionMammalianPromoterhSYN, U6Available SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHis-LMW_FGF2
Plasmid#157657PurposeExpresses FGF2 in E.coli cellDepositorInsertFibroblast growth factor 2 (FGF2 Human)
TagsHis tagExpressionBacterialMutationchanged Cystein 211,229 to serine, deleted amino …Available SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJet-CMV-IARS1[W435C]-GFP
Plasmid#212323PurposeEGFP-tagged IARS1 Trp435CysDepositorAvailable SinceNov. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
dCas9-FOG1[N+C]
Plasmid#100085PurposedCas9 fused to two FOG1 peptide [aa 1-45] , one at the N-terminus and one at the C-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsertFOG1(aa 1-45) (ZFPM1 Human)
UseCRISPRTags3XFLag-NLS-FOG1-dCas9-FOG1-NLSExpressionMammalianPromoterCMVAvailable SinceOct. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cn-VA-NHEJ1-WT
Plasmid#141339PurposeLentiviral vector for expression of human NHEJ1-WT in mammalian cellsDepositorInsertNHEJ1 (NHEJ1 Human)
UseLentiviralTagsVA tag (3XFLAG-2XTEV-6XHis-2XStrep-Beacon)ExpressionMammalianPromoterCMVAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPSF4
Plasmid#155477PurposeFor use in RBP tethering screenDepositorAvailable SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pL452-Sf3b1-K700E
Plasmid#90425Purposeselectable HDR vector to introduce K700E mutation within mus Sf3b1 gene (for use with sgSf3b1(T1) and pL452(hygro)-Sf3b1-K700K plasmids enabling generation of hemizygous K700E mutation)DepositorInsertSf3b1 - left and right homology arms (Sf3b1 Mouse)
UseHomology-directed repair vectorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-Puro
Plasmid#171992PurposeDelivers all prime editing nuclease components in a single, puromycin selectable plasmidDepositorInsertCbH-Cas9-RT-T2A-Puro, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
ExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC-tdTomato
Plasmid#62516PurposeExpresses tdTomato under the UbC promoter. This promoter expresses transgenes in neurons at higher levels than plasmids with the CMV. Optimal for tracing axons in tissue clearing proceduresDepositorInserttdTomato
UseAAV and Synthetic BiologyExpressionMammalianPromoterhUbCAvailable SinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC-eGFP
Plasmid#62518PurposeExpresses GFP under the UbC promoter. This promoter expresses transgenes in neurons at higher levels than plasmids with the CMV. Optimal for tracing axons in tissue clearing procedures.DepositorInserteGFP
UseAAVExpressionMammalianPromoterhUbCAvailable SinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ96 AAV-SpABE8e-N-terminus_tracrRNA
Plasmid#211817PurposeAAV vector expressing N-terminal of SpCas9-ABE8e and tracrRNADepositorInsertN-terminus of SpCas9-ABE8e and tracrRNA
UseAAVExpressionMammalianPromoterchicken β-actin promoter and U6 promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ100 AAV-SpABE8e-C_terminus-tracrRNA
Plasmid#211818PurposeAAV vector expressing C-terminus of SpCas9-ABE8e with tracrRNADepositorInsertC-terminus of SpCas9-ABE8e and tracrRNA
UseAAVExpressionMammalianPromoterchicken β-actin promoter and U6 promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
Donor_ANKRD1_KO_Puro
Plasmid#186667PurposeDonor plasmid to endogenously knock out the ANKRD1 in Hek293 cells. eEF1a promoter, puromycin and polyA sequence is inserted between two homology arms.DepositorInsertANKRD1 KO Puromycin (ANKRD1 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-GFP
Plasmid#171994PurposeDelivers all prime editing nuclease components in a single, GFP selectable plasmidDepositorInsertCbH-Cas9-RT-T2A-GFP, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
ExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-AtTAS1c-D2-B/c-AtMIR173
Plasmid#137885PurposePlant expression vector for direct cloning of synthetic trans-acting siRNAs into Arabidopsis thaliana TAS1c precursor downstream 3'D1[+]. Contains AtMIR173 for syntasi expression in any plant species.DepositorInsertsAtTAS1c-D2-B/c
2x35S-AtMIR173-Tnos
ExpressionPlantMutationA. thaliana TAS1c precursor sequence including a …Available SinceMay 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
Donor_YTHDF2_KO_Hygro
Plasmid#186671PurposeDonor plasmid to endogenously knock out the YTHDF2 in Hek293 cells. Hygromycin and polyA sequence is inserted between two homology arms.DepositorInsertYTHDF2 KO Hygromycin (YTHDF2 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Donor_YTHDF2_KO_Puro
Plasmid#186670PurposeDonor plasmid to endogenously knock out the YTHDF2 in Hek293 cells. Puromycin and polyA sequence is inserted between two homology arms.DepositorInsertYTHDF2 KO Puromycin (YTHDF2 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
AID-C12*-BE4max
Plasmid#216729PurposeExpresses a BE4max base editing construct comprised of the hyperactive AID-C12* and nCas9 (Cas9 with D10A mutation) in mammalian cells.DepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 4 CMV GST mTagBFP
Plasmid#206259PurposeENTR Vector 4 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes mTagBFP localised to Golgi organelles under the control of CMV promoter.DepositorInsertGTS mTagBFP
UseMultimate/gateway entr 4TagsBFGT1 (Golgi localisation peptide)ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only