We narrowed to 15,447 results for: grn
-
Plasmid#186931PurposeH3f3b sgRNA used for genomic targeting at H3f3b C-terminalDepositorPublicationAvailable sinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only
-
px459-H3.1 (Hist1h3g) sgRNA
Plasmid#186930PurposeHist1h3g sgRNA used for genomic targeting at Hist1h3g C-terminalDepositorPublicationAvailable sinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458_miR-290-295KO-gRNA1
Plasmid#172709PurposeCas9 with 5' gRNA for paired CRISPR KO of miR-290-295 clusterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmiR-290-295
UseCRISPRAvailable sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458_miR-290-295KO-gRNA2
Plasmid#172710PurposeCas9 with 3' gRNA for paired CRISPR KO of miR-290-295 clusterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmiR-290-295
UseCRISPRAvailable sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX601‐mhCMV‐ABEmaxNGA‐C3‐ E53ogRNA
Plasmid#187063PurposeNpu Split C-terminal half of ABEmaxNGA with gRNA targeting mdx4cv nonsense mutationDepositorInsertNpu Split C-terminal half of ABEmaxNGA with gRNA targeting mdx4cv nonsense mutation
UseAAV and CRISPRExpressionMammalianPromotermhCMVAvailable sinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ACTB_sgRNA
Plasmid#183884PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ACTB sgRNA for N-terminal tagging of beta-actin in human cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertACTB sgRNA spacer (ACTB Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-TUBA1B_sgRNA
Plasmid#183888PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and TUBA1B sgRNA for N-terminal tagging of alpha-tubulin in human cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTUBA1B sgRNA spacer (TUBA1B Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-RHOA_sgRNA
Plasmid#183877PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and RHOA sgRNA for N-terminal tagging of RhoA in human cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRHOA sgRNA spacer (RHOA Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYJ34-PB-CRISPR-BANCR-E1-gRNA
Plasmid#131077Purposelong non-coding RNA BANCR knock outDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBANCR Exon1 gRNA (BANCR Human)
UseCRISPRExpressionMammalianAvailable sinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSpCas9-Puro HLAG-2B-sgRNA
Plasmid#182552PurposeCas9 from S.pyogenes with 2A-Puro, and the 2B-sgRNA to targeting exon 2 of human HLA-G geneDepositorInserthSpCas9-2A-Puro-HLAG-2B-sgRNA
UseCRISPRExpressionMammalianPromoterCbhAvailable sinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
DmU6 3p3 GFP LgRNA
Plasmid#182207PurposeFor generation of plasmids for CRISPR-mediated 3p3 GFP knockin in DrosophilaDepositorInsert3XP3-GFP
UseCRISPRExpressionInsectAvailable sinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
PasCas13b-gRNA-EGFP(W58stop)
Plasmid#180507PurposePasCas13b-gRNA targeting EGFP(W58stop) for RNA editingDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPasCas13b-gRNA targeting EGFP(W58stop)
UseCRISPRExpressionMammalianPromoterU6Available sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
PasCas13b-gRNA-Nluc(W12stop)
Plasmid#180506PurposePasCas13b-gRNA targeting Nluc(W12stop) for RNA editingDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPasCas13b-gRNA targeting Nluc(W12stop)
UseCRISPRExpressionMammalianPromoterU6Available sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA iRFP713_zhang2.0
Plasmid#167916PurposeLentiviral vector for expressing U6 MS2-sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA Puro_zhang2.0
Plasmid#167919PurposeLentiviral vector for expressing U6 MS2-sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA Blasto_zhang2.0
Plasmid#167912PurposeLentiviral vector for expressing U6 MS2-sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA iRFP713
Plasmid#167908PurposeLentiviral vector for expressing U6 sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA(MS2)_zeo_hPDX1_promoter_guide1
Plasmid#176838PurposeTo induce human PDX1 expression by recruiting SAM complex to PDX1 promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgPDX1
ExpressionMammalianPromoterU6Available sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only