We narrowed to 172,265 results for: Gene
-
Plasmid#67509PurposeThis is an envelope gene encoding plasmid to make retrogradely lentiviral vector. If you use this plasmid, you can make type E envelope coating virus particle with NeuRet.DepositorInsertFusion Glycoprotein type E
UseLentiviralTagsFusion protein of Vesicular stomatitis Indiana vi…PromoterCAGGSAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral mBmal1-Luc
Plasmid#182762PurposeLentiviral vector encoding the promoter region of mouse Bmal1 gene driving a luciferase reporterDepositorAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pK068.CAG-FRT-stop-FRT-EGFP-ires-tTA-WPRE (Supernova)
Plasmid#85008PurposeFor Flpe/FRT-based Supernova-GFP, pK068 should be used with pK036. The GFP fragment of pK068 can be replaced with another gene by SalI and EcoRV.DepositorInsertEGFP-ires-tTA
ExpressionMammalianAvailable SinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-HA
Plasmid#61355Purposeencodes c-terminal HA-tagged S. pyogenes dCas9 driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal HA tag
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterCMVAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJL358
Plasmid#243712PurposeA piggyBac vector containing the COX7A2 coding sequence (CDS) flanked by the 5' UTR of the COX7A2 gene and 3' UTR of the ACTB geneDepositorInsert5' UTR and CDS of COX7A2, followed by the 3' UTR of the ACTB gene (COX7A2 Human)
ExpressionMammalianPromoterendogenous promoterAvailable SinceNov. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B
Plasmid#103002Purposenon-standard AAV2 rep-AAV-PHP.B cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFOS WT-GL3
Plasmid#11983PurposeReporter gene with mouse c-fos promoter. Induced by serum and many growth factors in quiescent cells.DepositorAvailable SinceAug. 10, 2007AvailabilityAcademic Institutions and Nonprofits only -
pY108 (lenti-AsCpf1)
Plasmid#84739PurposeLenti virus delivery of AsCpf1 and crRNA guideDepositorInsertshuAsCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
8xNFAT-ZsG-hCD4
Plasmid#162746PurposeNFAT-driven ZsGreen-1 reporter gene with human CD4 geneDepositorInsert8x of NFAT binding motif follwed by ZsGreen-1 fluorescent protein gene (CD4 Human)
UseRetroviralExpressionMammalianAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
iOn-CAG∞MCS
Plasmid#154013PurposeExpression vector based on the iOn integration-coupled transcriptional switch (Kumamoto et al bioRxiv 2019), equipped with an MCS to clone-in genes of interest and express it from a CAG promoterDepositorInsertMCS
ExpressionMammalianPromoterCAGAvailable SinceJuly 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pY109 (lenti-LbCpf1)
Plasmid#84740PurposeLenti virus delivery of LbCpf1 and crRNA guideDepositorInsertshuLbCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pK038.CAG-loxP-stop-loxP-EGFP-ires-tTA-WPRE (Supernova)
Plasmid#85006PurposeFor Cre/loxP-based Supernova-GFP, pK038 should be used with pK031. The GFP fragment of pK038 can be replaced with another gene by using SalI and EcoRV sites.DepositorInsertEGFP-ires-tTA
ExpressionMammalianAvailable SinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-opEBNA2-IRES-mCherry
Plasmid#220355PurposeExpresses EBV latent gene EBNA2 in mammalian cells (EBNA2 coding sequence was optimised for expression)DepositorInsertopEBNA2 (EBNA-2 Epstein-Barr Virus (EBV) strain B95-8)
UseRetroviralExpressionMammalianMutationcodon-optimised for expression in mammalian cellsAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDGB3omega1_KanR_BastaR
Plasmid#186426Purposeoptimisation of phosphinothricin (Basta) selection in plant cells; combines kanamycin resistance gene (nptII) and Basta resistance gene (bar)DepositorInsertsKanR
BastaR
UseSynthetic Biology; Binary vector for escherichia …ExpressionPlantMutationBsaI and BsmBI sites removedPromoterCaMV 35S and PnosAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-iCre-2A-cherry
Plasmid#182246PurposeExpresses iCre linked to mCherry. The promoter is a fragment of the hdc gene promoter which drives pan neuronal expression.DepositorInsertpan neuronal gene promoter (hdc) fragment driving iCre recombinase and 2A linked to mCherry
UseAAV and Cre/LoxExpressionMammalianPromoterfragment of histidine decarboxylase gene promoter…Available SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB167 - pL2_pSB90_2x35S::fLUC-I::tNOS_tMAS::rLUC-I::pMAS
Plasmid#123200Purposebinary plant vector for transient expression of a Renilla luciferase (rLUC, with intron) and a firefly luciferase (fLUC, with intron) in plantsDepositorInsert2x35S::fLUC-I::tNOS tMAS::rLUC-I::pMAS
UseLuciferaseExpressionPlantAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dsRed2-Triplex-28-gRNA3-28-gRNA4-28-gRNA5-28-gRNA6-28-pA
Plasmid#55202PurposePlasmid encoding multiplexed 4x gRNAs. This is a modified form of the original plasmid described in the paper (Construct 19). mKate2 was replaced with dsRed2 because of distribution issues.DepositorInsertdsRed2
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-hSyn1-EGFP
Plasmid#153205PurposeHuman synapsin-1 (hSyn1) promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only