We narrowed to 10,104 results for: transfer
-
Plasmid#194975PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4d) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-hSyn-fDIO-mEGFP-Gphn_P1
Plasmid#194978PurposeAAV vector to drive the Flp-dependent expression of mEGFP (L221K) -Gphn (isoform P1) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_P1
Plasmid#194972PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform P1) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4c
Plasmid#194974PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4c) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EGFP barcode-7-SV40 polyA
Plasmid#190871PurposeFor barcoded retrograde labelingDepositorInsertEGFP-barcode7
UseAAVMutationWTAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EGFP barcode-8-SV40 polyA
Plasmid#190872PurposeFor barcoded retrograde labelingDepositorInsertEGFP-barcode8
UseAAVMutationWTAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EGFP barcode-6-SV40 polyA
Plasmid#190870PurposeFor barcoded retrograde labelingDepositorInsertEGFP-barcode6
UseAAVMutationWTAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-Gat1(R69K)-HA-WPRE-HGHpA
Plasmid#184636PurposeExpresses the GABA membrane transporter Gat1 R69K mutant fused to HA, driven by the Ef1a promoter, in a Cre-dependent fashionDepositorInsertGat1 (Slc6a1 Mouse)
UseAAVMutationGat1 gene with Arginine 69 changed to Lysine, to …PromoterEF1aAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TetO(3G)-GCaMP6f-WPRE
Plasmid#186205PurposeExpress GCaMP6f under TetO(3G)DepositorInsertGCaMP6f
UseAAVTags6xHis (N terminal on insert), T7 epitope, and Xpr…PromoterTetO(3G)Available SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pICSL86977OD:PITG_15278a
Plasmid#173545PurposeThis is a binary plasmid that can be transferred into Agrobacterium and used to transiently express the protein encoded by the insert in plants by agro-infiltration.DepositorInsertPITG_15278_P17777
ExpressionPlantPromoter35SAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pICSL86977OD:PITG_14371
Plasmid#173567PurposeThis is a binary plasmid that can be transferred into Agrobacterium and used to transiently express the protein encoded by the insert in plants by agro-infiltration.DepositorInsertPITG_14371_T30-4
ExpressionPlantPromoter35SAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL86977OD:PITG_11947
Plasmid#173566PurposeThis is a binary plasmid that can be transferred into Agrobacterium and used to transiently express the protein encoded by the insert in plants by agro-infiltration.DepositorInsertPITG_11947_T30-4
ExpressionPlantPromoter35SAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL86977OD:PITG_07558
Plasmid#173565PurposeThis is a binary plasmid that can be transferred into Agrobacterium and used to transiently express the protein encoded by the insert in plants by agro-infiltration.DepositorInsertPITG_07558_T30-4
ExpressionPlantPromoter35SAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL86977OD:PITG_23226
Plasmid#173564PurposeThis is a binary plasmid that can be transferred into Agrobacterium and used to transiently express the protein encoded by the insert in plants by agro-infiltration.DepositorInsertPITG_23226_T30-4
ExpressionPlantPromoter35SAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL86977OD:PITG_22922
Plasmid#173563PurposeThis is a binary plasmid that can be transferred into Agrobacterium and used to transiently express the protein encoded by the insert in plants by agro-infiltration.DepositorInsertPITG_22922_T30-4
ExpressionPlantPromoter35SAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL86977OD:PITG_22870
Plasmid#173562PurposeThis is a binary plasmid that can be transferred into Agrobacterium and used to transiently express the protein encoded by the insert in plants by agro-infiltration.DepositorInsertPITG_22870_T30-4
ExpressionPlantPromoter35SAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL86977OD:PITG_22804
Plasmid#173561PurposeThis is a binary plasmid that can be transferred into Agrobacterium and used to transiently express the protein encoded by the insert in plants by agro-infiltration.DepositorInsertPITG_22804_T30-4
ExpressionPlantPromoter35SAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL86977OD:PITG_22547
Plasmid#173560PurposeThis is a binary plasmid that can be transferred into Agrobacterium and used to transiently express the protein encoded by the insert in plants by agro-infiltration.DepositorInsertPITG_22547_T30-4
ExpressionPlantPromoter35SAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL86977OD:PITG_21388
Plasmid#173559PurposeThis is a binary plasmid that can be transferred into Agrobacterium and used to transiently express the protein encoded by the insert in plants by agro-infiltration.DepositorInsertPITG_21388_T30-4
ExpressionPlantPromoter35SAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only