We narrowed to 11,256 results for: aav
-
Plasmid#192070PurposeExpression of BFP, sesRNA in mammalian cells, with tTA2 as efRNA.DepositorInsertsesRNA for tdTom
UseAAVExpressionMammalianPromoterCAGAvailable sinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hGfap-R-CaMP1.07-WPRE-SV40
Plasmid#164140PurposeAAV vector to express the red Ca2+ indicator R-CaMP1.07 in astrocytes.DepositorPublicationInsertR-CaMP1.07
UseAAVPromoterhGFAPAvailable sinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-TVA66T-EGFP
Plasmid#64091PurposeExpresses TVA66T-EGFP under the CAG promotorDepositorInsertTVA66T-EGFP
UseAAV and Cre/LoxTagsEGFPExpressionMammalianMutationGlutamic acid 66 to ThreoninePromoterCAGAvailable sinceApril 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-minBG-SYFP2
Plasmid#236723PurposeSYFP2-taggedDepositorInsertSYFP2
UseAAVAvailable sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-DEST(f)
Plasmid#190226PurposeGateway destination vector, empty AAV vector backboneDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable sinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E7-dTom-nls-dTom
Plasmid#135642PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E7 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E9-dTom-nls-dTom
Plasmid#135644PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E9 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FLEX-ArchT-GFP
Plasmid#58851PurposeAAV-mediated expression of ArchT-GFP under the EF1a promoter, in floxed/reversed (Cre-dependent) mannerDepositorInsertArchT-GFP
UseAAV and Cre/LoxTagsGFPExpressionMammalianPromoterEF1aAvailable sinceAug. 14, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-hSyn-ConVERGD-TVA(mChr)-W3SL
Plasmid#218754PurposeProvides AND intersectional (Cre+Flp) expression of TVA-mCherryDepositorInsertTVA-mCherry
UseAAVTagsmCherryPromoterhSynAvailable sinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-HA-HCARD-P2A-mCitrine
Plasmid#228902PurposeFor AAV packaging and Cre-dependent expression of a peripherally restricted DREADDDepositorHas serviceAAV8Inserthydroxycarboxylic acid receptor 2 (Hcar2 Mouse)
UseAAV and Synthetic BiologyTagsHA and P2A mCitrineExpressionMammalianMutationR108KPromoterChicken Beta ActinAvailable sinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-PinkyCaMP
Plasmid#232860PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under CAG promoterDepositorInsertPinkyCaMP
UseAAVExpressionMammalianPromoterCAGAvailable sinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-eBFP2-NLS-pA
Plasmid#183800PurposeAAV vector to express nuclear localized eBFP2 from CMV promoterDepositorInserteBFP2-NLS
UseAAVTagsNLSAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eGFP-2A-TetanusToxin (Cre-OFF)
Plasmid#166611PurposeEncodes Cre-inactivated GFP-2A-Tetanus toxin light chain under control of the TREDepositorInsertEGFP-2A-Tetanus Toxin
UseAAVPromotertetracycline response elementAvailable sinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
132_pAAV-ProB2-CatCh-GFP-WPRE
Plasmid#125922PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB2Available sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
p-AAV2-hSyn-MerMAID6-Citrine
Plasmid#126521PurposeAnion-conducting Channelrhodopsin with near-complete desensitization in continuous light. Codon-optimized for mammalian expression (human/mouse).DepositorInsertMerMAID6
UseAAVTagsCitrinePromoterhuman synapsinAvailable sinceNov. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13V/sgKras/Cre
Plasmid#99860PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13V mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAVS hOPM
Plasmid#112498PurposeHomologous recombination vector for dox-inducible overexpression of OTX2, PAX6, and MITF in AAVS locus.DepositorAvailable sinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pOTTC385 - pAAV CMV-IE IRES EGFP
Plasmid#102936PurposeAn AAV vector that expresses IRES EGFP under the CMV-IE promoterDepositorInsertEGFP
UseAAVExpressionMammalianPromoterCMV-IEAvailable sinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV_Donor/Reporter-COL4A5
Plasmid#130280PurposeCOL4A5 mutation-specific sgRNA under the control of U6 promoter; mCherry-sgRNA target-(out of frame)EGFP expression cassette; COL4A5 donor templateDepositorInsertmCherry-eGFP
UseAAVPromoterCMVAvailable sinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only