We narrowed to 6,247 results for: nls
-
Plasmid#245089PurposeLentiviral vector with nuclear fluorescent reporter AcGFP expressed from Rat TAC1 promoterDepositorInsertAcGFP
UseLentiviralTags3x SV40 NLSExpressionMammalianPromoterRat TAC1 promoterAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
SIN-GluR1-AcGFPnuc-WPRE
Plasmid#245092PurposeLentiviral vector with nuclear fluorescent reporter AcGFP expressed from Rat GluR1 promoterDepositorInsertAcGFP
UseLentiviralTags3x SV40 NLSExpressionMammalianPromoterRat GluR1 promoterAvailable SinceOct. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
CARMEN
Plasmid#240464PurposeCompartment-specific measurements of Ca²⁺ dynamics by intensiometric Ca²⁺ biosensors targeted to mitochondria, cytosol and ERDepositorInsertCARMEN
ExpressionMammalianAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
WT-Cas9
Plasmid#239382PurposeFor circular RNA-mediated inverse prime editor using WTCas9 in HEK294T cellsDepositorInsertCas9
UseCRISPRTagsBPNLS and SV40 NLSExpressionMammalianPromoterCMVAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG3666_pGEEC576_pShip-EFS-ZF43a(inducible)-P2A-iRFP720-bGH
Plasmid#239740PurposePlasmid expressing a rapamycin-inducible transcriptional activatorDepositorInsertNLS-FXBP-ZF43-P2A-NES-VP64-FRB-P2A-iRFP720
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT44
Plasmid#223416PurposeT-DNA vector for temperature tolerance LbCas12a-D156R based mutagenesis for monocot plants; TTTV PAM; LbCas12a-D156R and the crRNA were driven by separate ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-LbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT47
Plasmid#223419PurposeT-DNA vector for Mb2Cas12a-RVRR based mutagenesis for monocot plants; more relaxed PAM requirements; Mb2Cas12a-RVRR and the crRNA were driven by separate ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-Mb2Cas12a-RVRR-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT48
Plasmid#223420PurposeT-DNA vector for Mb2Cas12a-RVRR based mutagenesis for dicot plants; more relaxed PAM requirements; Mb2Cas12a-RVRR and the crRNA were driven by separate 2x35s promoter; Kanamycin for plants selection.DepositorInsert2x35s-Mb2Cas12a-RVRR-2x35s-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT49
Plasmid#223421PurposeT-DNA vector for LbCas12a-RRV based mutagenesis for monocot plants; highly efficient including TTV PAM; LbCas12a-RRV and the crRNA were driven by separate ZmUbi1 promoter; BASTA for plants selection.DepositorInsertZmUbi-LbCas12a-RRV-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT50
Plasmid#223422PurposeT-DNA vector for LbCas12a-RRV based mutagenesis for monocot plants; highly efficient including TTV PAM; LbCas12a-RRV and the crRNA was driven by separate ZmUbi1 promoter; Hygromycin for plants select.DepositorInsertZmUbi-LbCas12a-RRV-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT52
Plasmid#223424PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate ZmUbi1 promoter; BASTA for plants selection.DepositorInsertZmUbi-ecTadA8e-dLbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT53
Plasmid#223425PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-dLbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT54
Plasmid#223426PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate 2x35s promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-dLbCas12a-D156R-2x35s-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT33
Plasmid#223405PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for dicot plants; NGG PAM; SpCas9D10A-ABE was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-SpCas9-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT34
Plasmid#223406PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT35
Plasmid#223407PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT36
Plasmid#223408PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only