We narrowed to 7,585 results for: mCherry
-
Plasmid#178545PurposepTatABC with an mCherry fluorescent protein tag at the end of TatB.DepositorInsertTatA, TatBmCherry, TatC
TagsmCherry fused to TatBExpressionBacterialPromoteraraCAvailable sinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-PS
Plasmid#86628PurposeExpresses Akt pseudosubstrate tagged with mCherryDepositorInsertAkt pseudosubstrate (VELDPEFEPRARERAYAFGH)
ExpressionMammalianAvailable sinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAT15415-BEAR-GFP-target-mCherry
Plasmid#162995Purposeplasmid expressing an sgRNA targeting the BEAR-GFP plasmid along with an mCherry markerDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting the BEAR-GFP plasmid
UseCRISPRExpressionMammalianPromoterU6Available sinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-pX330-Cas9-mCherry
Plasmid#159742PurposeExpresses Cas9-2A-mCherry and a sgRNA excising EGFP flanked by a splice acceptor and a splice donor from the Intron-Tagging-EGFP-Donor plasmid.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdonor plasmid targeting sgRNA
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
XLone-BSD Cas13d P2A mCherry
Plasmid#155183PurposePiggybacTransposon-based tunable and temporal expression control of Cas13d and mCherryDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCasRx
UseUnspecified; Piggybac transposonTagsNLS and P2A mCherryExpressionMammalianPromoterTRE3GAvailable sinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
P-Ef1a-mCherry-T2A-RPL22-1xV5
Plasmid#170324PurposeExpresses V5 and mCherry tagged RPL22DepositorAvailable sinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAF0362 Ef1a-Cp36_attP-Puro-p2a-mCherry donor
Plasmid#193469PurposeCp36 Donor with promoter for mcherry and puro expressionDepositorInsertCp36_attP
ExpressionMammalianAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available sinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMVTO-mCherry-Kir2.1-HA-tevs-RXR
Plasmid#179704PurposeTEVP-inducible mCherry-conjugated Kir2.1 RELEASEDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertKir2.1
ExpressionMammalianAvailable sinceMarch 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCBh_3x Flag-NLS-enRhCas12f1-NLS_pA_phU6_gRNA scaffold-spacer_pCMV_mCherry_pA
Plasmid#197027PurposeVector encoding a human codon-optimized enRhCas12f1 driven by CBh promoter, guide RNAs compatible with enRhCas12f1 driven by hU6, and mCherry driven by CMV promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthumanized enRhCas12f1
ExpressionMammalianMutationL270RPromoterCBh, CMV, hU6Available sinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-RILPL1
Plasmid#244980PurposeExpress RILPL1 in mammalian cells with mCherry tagDepositorAvailable sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Spe4-Rfa-mCherry-stop
Plasmid#186388PurposeDestination vector for the expression of a fluorescent fusion of a protein of interest with C-ter mCherry into embryos, by mRNA microinjectionDepositorTypeEmpty backboneUseGateway CloningAvailable sinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Spe4-Kozak-mCherry-RfA
Plasmid#186378PurposeDestination vector for the expression of a fluorescent fusion of N-ter mCherry and a protein of interest into embryos, by mRNA microinjectionDepositorTypeEmpty backboneUseGateway CloningAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTMiniTrex-mCherry-Shark1
Plasmid#233143PurposeServes as a template plasmid for amplifying Shark1 (Tet-OFF) hammerhead aptazyme-3xTy-tagging cassetteDepositorInsertsmCherry
Shark1
UseProkaryotic expressionTags3x Ty tagMutationCodon optimized for Trypanosoma cruzi and changed…Available sinceMarch 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCS2-mCherry_SNAP_SNAPV_PACT_Dead
Plasmid#173073PurposeDead SNAP tag at the centrosomeDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmCherry-SNAP-SNAP-Varied-PACT
TagsmCherry-SNAP-SNAP-VariedExpressionMammalianMutationAA144 in both SNAP tags changed from a cysteine t…PromoterCMV IE94Available sinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tet-O-FUW-FOSL2-P2A-mCherry
Plasmid#203860PurposeTet-inducible lentiviral plasmid expressing FOSL2-P2A-mCherry, with ORF specific barcode close to 3'LTR siteDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFOSL2 (FOSL2 Human)
ExpressionMammalianAvailable sinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-H3.3(K36M)-3AID-HA-2A-mCherryBSD
Plasmid#225699PurposeLentiviral expression of AID degron tagged H3.3(K36M) and mCherry fused BlasticidinRDepositorUseLentiviral and Synthetic BiologyTags3xAID HA and T2A-mCherryExpressionMammalianMutationK36MPromoterpEF1AAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cry2 mCherry RGS4(del 1-33) in pcDNA3.1
Plasmid#64207PurposemCherry fused between Cry2 and RGS4(del 1-33) to study cell migrationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNATagsmcherryExpressionMammalianPromoterCMVAvailable sinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
miABE
Plasmid#205412PurposeVector encoding human codon-optimized enhanced-activity nOgeuIscB fusion with TadA8e driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpU6-_RNA*-pCAG-bpNLS-TadA8e(V106W)-32aa-OgeuIscB*(D61A)-GS-bpNLS-GS-TadA8e(V106W)-bpNLS-bGH polyA-pCMV-mCherry-AmpR
ExpressionMammalianMutationD61A+E85R+H369R+S387R+S457RPromoterhU6, CAG, CMVAvailable sinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pNQL004-SOX2-FKBPV-HA2-P2A-mCherry targeting construct
Plasmid#175552PurposeTargeting vector to introduce an FKBPV-HA2-P2A-mCherry cassette at the mouse SOX2 locus. Degradation Tag (dTAG) system.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSOX2 (Sox2 Mouse)
UseMouse TargetingTagsFKBPV-HA2-P2A-mCherryExpressionMammalianMutationnoneAvailable sinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only