-
Plasmid#165602PurposeExpresses Sp dCas9 fused to truncated human MSK1 (42-802)DepositorInsertS. Pyogenes dCas9 with c-terminal truncated human Mitogen- and stress-activated protein kinase-1 (42-802) (RPS6KA5 Human, S. Pyogenes, Synthetic)
UseCRISPR and LentiviralTagsFLAG TagExpressionMammalianMutationPromoterEF1aAvailable sinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
CROP-seq-opti
Plasmid#106280PurposeA version of the CROP-seq plasmid as presented in Datlinger et al. that contains the sgRNA-(F+E)-combined optimized backbone for CRISPRi from Chen et al.DepositorInsertEF1a-Puro-WPRE-hU6-gRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pY010 (pcDNA3.1-hAsCpf1)
Plasmid#69982PurposeExpresses humanized AsCpf1DepositorInserthAsCpf1
UseCRISPRTagsNLS-3xHAExpressionMammalianMutationPromoterCMVAvailable sinceOct. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ALK2 wt
Plasmid#80870Purposemammalian expression of ALK2 WTDepositorInsertALK2 (ACVR1 Human)
UseTagsHAExpressionMammalianMutationPromoterCMVAvailable sinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pmAmetrine-DEVD-tdTomato
Plasmid#18879PurposeCaspase-3 FRET biosensor, mammalian expression of mAmetrine-DEVD-tdTomatoDepositorInsertmAmetrine-DEVD-tdTomato (CASP3 lab constructed, Human)
UseTagsExpressionMammalianMutationmAmetrine-tdTomato linker sequence: ...ITLGGTGSGS…PromoterAvailable sinceAug. 13, 2008AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2(mScarlet-FLAG)#11 in pTwist-CMV backbone
Plasmid#216155PurposeExpresses mScarlet in cells with TDP-43 loss-of-function. Very bright and decent dynamic range (>10-fold), slightly leaky. It uses a single intron. [Code 'B12']. Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertmScarlet with cryptic splice site and C-terminal FLAG tag
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
Flag-HA-USP5
Plasmid#22590DepositorInsertUSP5 (USP5 Human)
UseRetroviralTagsFLAG and HAExpressionMammalianMutationNonePromoterAvailable sinceNov. 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
hSyn-DIO-somBiPOLES-mCerulean (AAV5)
Viral Prep#154951-AAV5PurposeReady-to-use AAV5 particles produced from hSyn-DIO-somBiPOLES-mCerulean (#154951). In addition to the viral particles, you will also receive purified hSyn-DIO-somBiPOLES-mCerulean plasmid DNA. Synapsin-driven, Cre-dependent expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCerulean (Cre-dependent)Available sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIRES2_EGFP_KCNQ1
Plasmid#173161PurposeFor mammalian expression of KCNQ1 and creating variantsDepositorInsertKCNQ1 (KCNQ1 Human)
UseTagsIRES2-EGFPExpressionMammalianMutationPromoterCMVAvailable sinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT1T2
Plasmid#50590PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT1, U626t plus, U629p, T2
UseCRISPR; Pcr templateTagsExpressionPlantMutationPromoterAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP7f-WPRE (AAV PHP.eB)
Viral Prep#104492-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pGP-AAV-syn-FLEX-jGCaMP7f-WPRE (#104492). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP7f-WPRE plasmid DNA. Syn-driven, Cre-dependent GCaMP7f calcium sensor. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailable sinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
p8.91
Plasmid#187441PurposeLentiviral packaging plasmid expressing gag and pol.DepositorInsertsUseLentiviralTagsExpressionMutationPromoterAvailable sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.Luciferase.IRES.GFP
Plasmid#169308PurposeConstitutive overexpression of Luciferase cDNA with GFP as a reporter fluorescent proteinDepositorInsertLuciferase
UseLentiviralTagsIRES-EGFPExpressionMutationPromoterSFFVAvailable sinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRTagsExpressionMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-tdTomato (codon diversified) (AAV PHP.S)
Viral Prep#59462-PHP.SPurposeReady-to-use AAV PHP.S particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA. CAG-driven tdTomato expression control. These AAV were produced with the PHP.S serotype, which permits efficient transduction of the peripheral nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomato (codon diversified)Available sinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE (AAV1)
Viral Prep#179459-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE (#179459). In addition to the viral particles, you will also receive purified pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE plasmid DNA. EF1a-driven, Cre-dependent soma and AIS-localized expression of voltage indicator JEDI-2P. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagscEGFP (Cre-dependent)Available sinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#206994PurposePlasmid expressing both SpCas9 and SaCas9DepositorUseTagsP2AExpressionMammalianMutationPromoterCMVAvailable sinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDNR-gRNA
Plasmid#206990PurposeA plasmid for expression of SaCas9-sgRNA targeting donor plasmidsDepositorInsertDonor plasmid-targeting SaCas9-gRNA
UseTagsExpressionMammalianMutationPromoterU6Available sinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133B2.0
Plasmid#99892PurposeGolden Gate entry vector to express the 3rd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterAtU3Available sinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUAS-luc2
Plasmid#24343DepositorInsertLuciferase
UseTags5XGAL4ExpressionMammalianMutationPromoterAvailable sinceMay 10, 2010AvailabilityAcademic Institutions and Nonprofits only