We narrowed to 27,790 results for: Ung;
-
Plasmid#101185PurposeHuman expression plasmid for SpCas9 Cluster 2 variant: CMV-T7-hSpCas9-Cluster2(G582A, V583A, E584A, D585A, N588A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-Cluster2(G582A/V583A/E584A/D585A/N588A)
Tags3x FLAG and NLS (SV40)ExpressionMammalianMutationG582A/V583A/E584A/D585A/N588APromoterCMVAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
SL542
Plasmid#49951PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
SL544
Plasmid#49970PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL545
Plasmid#49953PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL543
Plasmid#49952PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL541
Plasmid#49950PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL540
Plasmid#49949PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBp-FGFR2c-E471Q
Plasmid#45704DepositorAvailable SinceJune 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-PuroR
Plasmid#174090PurposeCRISPaint gene taggingDepositorInsertmNeonGreen
UseGene taggingAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only