We narrowed to 15,163 results for: GRN

#87389

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87393

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87398

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87408

p426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87385

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#86005

plasmid vector encoding for U6-driven AAT_g1 gRNA

Tobias Cantz

Eggenschwiler et al Sci Rep. 2016 Dec 2;6:38198. doi: 10.103

Feb. 1, 2017

Academic Institutions and Nonprofits only

#86006

plasmid vector encoding for U6-driven AAT_g2 gRNA (Z-allele specific)

Tobias Cantz

Eggenschwiler et al Sci Rep. 2016 Dec 2;6:38198. doi: 10.103

Feb. 1, 2017

Academic Institutions and Nonprofits only

#81214

pHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 3' region of pCALNL_Ch5 reporter

David Liu

Chaikind et al Nucleic Acids Res. 2016 Aug 11. pii: gkw

Nov. 4, 2016

Academic Institutions and Nonprofits only

#81209

for targeting Ch10 psuedo gix site in PCDH15 gene (five base pairs from the cas9 site and 3' of gix site)

David Liu

Chaikind et al Nucleic Acids Res. 2016 Aug 11. pii: gkw

Nov. 4, 2016

Academic Institutions and Nonprofits only

#76329

3rd generation lentiviral gRNA plasmid targeting human GK

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#76326

3rd generation lentiviral gRNA plasmid targeting human GK

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#76327

3rd generation lentiviral gRNA plasmid targeting human GK

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#76328

3rd generation lentiviral gRNA plasmid targeting human GK

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#218710

AAV vector plasmid expressing Cas9 from Staphylococcus aureus (SaCas9) under the human synapsin (SYN) promoter and its sgRNA under the U6 promoter

Bart Nieuwenhuis

May 13, 2024

Academic Institutions and Nonprofits only

#126778

Expression plasmid for human codon-optimized increased fidelity HiFi SpCas9 (without U6-sgRNA coding sequence, with silent mutations)

Ervin Welker

Kulcsar et al Nat Commun. 2020 Mar 6;11(1):1223. doi:

March 6, 2020

Academic Institutions and Nonprofits only

#176461

Vector for constructing retron Ec73ncRNA-gRNA chimeric RNA (Ec73 rgRNA), inserting spacer sequence by BbsI digestion and inserting donor sequence by EcoRI digestion. EGFP(L202S)-P2A-mCherry driven by CMV

Hui Yang

Kong et al Protein Cell. 2021 Aug 17. pii: 10.1007/

Oct. 26, 2021

Academic Institutions and Nonprofits only