We narrowed to 9,087 results for: tet
-
Plasmid#64603Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only
-
MEK5 DD(S311D,T315D)-pcw107-V5
Plasmid#64619Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceJune 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
p38 WT O/E (MAPK14)-pcw107-V5
Plasmid#64624Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
MEK1-pcw107-V5
Plasmid#64650Purpose(control) when used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
ERalpha (Y537S mutant)-pcw107-V5
Plasmid#64634Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
Stat3 (A662C,N664C,V667L)-pcw107-V5
Plasmid#64611Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
Gli2 truncation-pcw107-V5
Plasmid#64626Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
Rgl2-CAAX-pcw107-V5
Plasmid#64641Purposewhen used to produce lentivirus, express physiological levels of insertDepositorInsertRgl2 plus C-term KRAS (Kras Mouse)
UseLentiviralTagsV5MutationC-term of KrasPromoterPGKAvailable SinceDec. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
JNK2 WT O/E (MAPK9)-pcw107-V5
Plasmid#64617Purposewhen used to produce lentivirus, express physiological levels of insertDepositorInsertMAPK9 (transcript variant JNK2-a2) (MAPK9 Human)
UseLentiviralTagsV5MutationnonePromoterPGKAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
FLAG-MKK6 (S207E,T211E)-pcw107
Plasmid#64625Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceJune 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
myr-FLAG-MEK5-pcw107
Plasmid#64620Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
FLAG-YAP2 (8SA)-pcw107
Plasmid#64637Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceDec. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
HRas (G12V, E37G)-pcw107
Plasmid#64639Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
HRas (G12V, E37G)-pcw107-V5
Plasmid#64640Purposewhen used to produce lentivirus, express physiological levels of insertDepositorInsertHRAS (transcript variant 3) (HRAS Human)
UseLentiviralTagsV5MutationG12V, E37GPromoterPGKAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLY70
Plasmid#130948PurposeA CRISPR activation device with the necessary genes (dxcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter PrhaB), and the reporter part (PpspA-LEA3B3 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
rhaS
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterPcon, PpspA-LEA3B3, PrhaB, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY61
Plasmid#130928PurposeA CRISPR activation device with the necessary genes (dxcas9 3.7 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA1B1 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterAnderson promoter: J23106, PpspA-LEA1B1, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ralstonia-GG-Kit
Plasmid Kit#1000000142PurposeBackbone vectors and Level I modules that can be used for assembly of Ralstonia solanacearum species complex gene knockout and complementation constructs based on Golden Gate cloning techniquesDepositorAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS2 (CK2alpha', CK2beta)
Plasmid#27093DepositorUseTetracycline-regulated expressionTagsHA and MycExpressionMammalianPromoterbidirectional tet-responsive promoterAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGV7 (CK2alpha' K69M, CK2beta)
Plasmid#27095DepositorUseTetracycline-regulated expressionTagsHA tag on CK2alpha' and Myc on CK2betaExpressionMammalianMutationK69M on CK2alpha'Promoterbidirectional tet-responsive promoterAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only