We narrowed to 4,733 results for: Gca
-
Plasmid#75649Purpose3rd generation lentiviral gRNA plasmid targeting human TSSK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
CSNK2A2 gRNA (BRDN0001144724)
Plasmid#75586Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK2A2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKCQ gRNA (BRDN0001147386)
Plasmid#75555Purpose3rd generation lentiviral gRNA plasmid targeting human PRKCQDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FLT1 gRNA (BRDN0001146782)
Plasmid#75558Purpose3rd generation lentiviral gRNA plasmid targeting human FLT1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TBCK gRNA (BRDN0001148062)
Plasmid#75565Purpose3rd generation lentiviral gRNA plasmid targeting human TBCKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MVK gRNA (BRDN0001145420)
Plasmid#77407Purpose3rd generation lentiviral gRNA plasmid targeting human MVKDepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
NEK8 gRNA (BRDN0001148289)
Plasmid#76942Purpose3rd generation lentiviral gRNA plasmid targeting human NEK8DepositorAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
AMHR2 gRNA (BRDN0001147673)
Plasmid#76658Purpose3rd generation lentiviral gRNA plasmid targeting human AMHR2DepositorAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
IP6K2 gRNA (BRDN0001146075)
Plasmid#77816Purpose3rd generation lentiviral gRNA plasmid targeting human IP6K2DepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pLenti_Cas9_GFP_CDC7_sg1
Plasmid#254533PurposeCDC7 knockoutDepositorAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-pa-u6ac-Lats1-guides
Plasmid#254766PurposeLat1 gRNA for neutrophil specific KO in tol2 backboneDepositorAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pscAAV-KIKO-U6-gTgfbr2-p2a-mCherry-STOPpA-400
Plasmid#249131Purposeall-in-one HDRT-based knockin-knockout (KIKO) design to insert mCherry (=knockin) at gTgfbr2 cut site, disrupting Osmr expression (=knockout)DepositorInsertgTgfbr2, mCherry (Tgfbr2 Synthetic, Mouse)
UseAAVAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_ZCRB1 (pAVA3300)
Plasmid#239325PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNA stargeting ZCRB1DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting ZCRB1 (ZCRB1 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_C1D (pP18(T)_B9-AVA4070)
Plasmid#239296PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting C1DDepositorInsertU6-driven sgRNA targeting C1D (C1D Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC5 (pP18(T)_B12-AVA4068)
Plasmid#239303PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC5DepositorInsertU6-driven sgRNA targeting EXOSC5 (EXOSC5 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPKR_2g)-PGKpuro2AmCherry-W
Plasmid#208435PurposeLentiviral gRNA plasmid targeting human PKR gene, co-expression of mCherry tagDepositorInsertPKR (EIF2AK2 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U9Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMTOR_1k)-PGKpuro2ABFP-W
Plasmid#208429PurposeLentiviral gRNA plasmid targeting human MTOR gene, co-expression of BFP tagDepositorInsertMTOR (MTOR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hRNF31_1k)-PGKpuro2ABFP-W
Plasmid#208414PurposeLentiviral gRNA plasmid targeting human RNF31 gene, co-expression of BFP tagDepositorInsertRNF31 (RNF31 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only