We narrowed to 7,798 results for: alp;
-
Plasmid#76464Purpose3rd generation lentiviral gRNA plasmid targeting human PAK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
CAMK2A gRNA (BRDN0001149531)
Plasmid#76928Purpose3rd generation lentiviral gRNA plasmid targeting human CAMK2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFB-EF1a-DIO-Rpl22l1-3xFLAG-2A-GFP
Plasmid#245377PurposeCre-dependent expression of FLAG-tagged Rpl22l1 and EGFP.DepositorAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV mTagBFP2-2A-CHMP2B-Q165X
Plasmid#232001PurposeBicistronic expression of CHMP2B Q165X mutant along with an mTagBFP2 transfection marker, connected via 2A sequences.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-3XHA
Plasmid#232003PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with a 3xHA tag.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOET3-6xHis-hSMSr-ΔSAMD
Plasmid#236225PurposeExpress N-terminal His-tagged human SMSr (SAMD8)-sterile alpha motif domain deletion mutant protein in insect cellsDepositorInsertSAMD8 (SAMD8 Human)
TagsHexa histidine tag (6xHis-tag) and enterokinase s…ExpressionInsectMutationsterile alpha motif domain at N-terminal (1-231 b…Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk3_#2-puro
Plasmid#231982PurposeKnockout mouse Ripk3DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk3 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk3_#1-puro
Plasmid#231981PurposeKnockout mouse Ripk3DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk3 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgMlkl_#2-puro
Plasmid#231980PurposeKnockout mouse MlklDepositorInsertsgRNA with Cas9 with puromycin resistance (Mlkl Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgMlkl_#1-puro
Plasmid#231979PurposeKnockout mouse MlklDepositorInsertsgRNA with Cas9 with puromycin resistance (Mlkl Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-DGKδ2
Plasmid#226506PurposeExpress N-terminal three tandem FLAG epitope tags, followed by an enterokinase cleavage site and human DGKD geneDepositorInsertDGKD (DGKD Human)
TagsThree tandem FLAG epitope tag and enterokinase cl…ExpressionMammalianPromoterCMVAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
HA-MAP4K4-10A
Plasmid#229403PurposeLentiviral or overpexression of cDNADepositorInsertMAP4K4 (MAP4K4 Human)
UseLentiviralTagsHAExpressionMammalianMutationMARK2 phosphosites (S523,S536,S547,S643,T684,S726…PromoterEFSAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MAP4K4-10D
Plasmid#229404PurposeLentiviral or overpexression of cDNADepositorInsertMAP4K4 (MAP4K4 Human)
UseLentiviralTagsHAExpressionMammalianMutationMARK2 phosphosites (S523,S536,S547,S643,T684,S726…PromoterEFSAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCA528 IST1 L328D (316-366)(C-Cys)
Plasmid#193035PurposeBacterial expression plasmid for IST1 (316-366) with C-terminal Cysteine for fluorescence polarization binding assays. Contains L328D mutation that diminishes binding to MIT domains.DepositorInsertIST1 (IST1 Human)
Tags6xHis-SumoExpressionBacterialMutationL328D, Residues 316-366, Non-native C-terminal Cy…PromoterT7Available SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCA528 IST1 L355A (316-366)(C-Cys)
Plasmid#193036PurposeBacterial expression plasmid for IST1 (316-366) with C-terminal Cysteine for fluorescence polarization binding assays. Contains L355A mutation that diminishes binding to MIT domains.DepositorInsertIST1 (IST1 Human)
Tags6xHis-SumoExpressionBacterialMutationL355A, Residues 316-366, Non-native C-terminal Cy…PromoterT7Available SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK zeta mouse
Plasmid#224577PurposeNegative Control for downregulation of the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgPet-1-hSyn-mCherry-KASH
Plasmid#223227PurposeguideRNA targeting the mouse Pet-1 (Fev)DepositorInsertFev (Fev Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
mTph2p(330bp)-mut1-Luc
Plasmid#223664PurposeFirefly-luciferase reporter expression driven by proximal 330-bp of mouse Tph2 promoter point mutation at RRE site 1DepositorInsertmTph2 promoter (Tph2 Mouse)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianPromotermTph2 promoterAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
mTph2p(330bp)-mut2-Luc
Plasmid#223665PurposeFirefly-luciferase reporter expression driven by proximal 330-bp of mouse Tph2 promoter point mutation at RRE site 2DepositorInsertmTph2 promoter (Tph2 Mouse)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianPromotermTph2 promoterAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only