We narrowed to 60,007 results for: tra
-
Plasmid#61983Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only
-
TFORF1304
Plasmid#144293PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
NET97 pmRFP-N2 (641)
Plasmid#61994Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSB96 - pL2_pSB90_2x35S::fLUC-I::tNOS
Plasmid#123188Purposebinary plant vector for transient fLUC (with intron) expressionDepositorInsert2x35S::fLUC-I::tNOS and VirGN54D in the vector backbone
UseLuciferaseExpressionPlantAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCLASP_Crz1(19A)_CLASP_RGS2membrane
Plasmid#133085PurposePlasmid contains Crz1* with CLASP. This consists of the plasma membrane anchor (pm-LOVTRAP) and the cargo (Zdk-Crz1*-yeLANS). CLASP modulates nuclear localization of Crz1* in response to blue light.DepositorInsertCrz1*-CLASP
ExpressionBacterial and YeastPromoterpADH1Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
NET37 pmRFP-N2 (450)
Plasmid#61980Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-NES-tdTomato-LINuS-WPRE
Plasmid#159894PurposeAAV expression of tdTomato fused to LINuS, a light-inducible nuclear localization signalDepositorInsertNES-tdTomato-LINuS
UseAAVExpressionMammalianPromoterEF1α promoterAvailable SinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
TAPBPL pEGFP-C3 (1765)
Plasmid#62055Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-V5-Mfsd10
Plasmid#120238PurposeExpresses V5-tagged Mfsd10 in lentiviral vectorDepositorAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pWal10-roe-sfGFP
Plasmid#240239PurposeGateway destination plasmid to generate C-terminal sfGFP fusions under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorTypeEmpty backboneUseGateway destination vectorExpressionInsectAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF0705
Plasmid#143727PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-hDLXI56i-minBG-CI-EGFP-W3SL-BC(p1-10)
Plasmid#231360PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses EGFP from the minBG promoter with hDLXI56i enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-mscRE4-minBG-CI-EGFP-W3SL-BC(p1-10)
Plasmid#231361PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses EGFP from the minBG promoter with mscRE4 enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-Ple155-CI-EGFP-W3SL-BC(p1-10)
Plasmid#231351PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses EGFP from Ple155 element, active in Purkinje cells.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-CMVe-SCP1-TagBFP2-W3SL-BC(p1-10)
Plasmid#231354PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses TagBFP from SCP1 promoter and CMV enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG-NLS-EGFP-WPRE-SV40pA-T7-T3-BC(p1-14)
Plasmid#231345PurposeSingle stranded AAV genome with components for tracking AAV genome via AAV-Zombie. Also expresses a nuclear localized EGFP from CAG promoter.DepositorInsertT7/T3-BC(p1-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_SBP-EGFP-CCR5
Plasmid#222309PurposeSynchronize the trafficking of CCR5 from the ER.DepositorAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF3223
Plasmid#144699PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -