We narrowed to 6,486 results for: nls
-
Plasmid#223407PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT36
Plasmid#223408PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Bxb1-GA_AIO-TetOn_mScarlet_Up-Tandem
Plasmid#229793PurposeBxb1-GA donor plasmid with upstream tandem syntax for all-in-one doxycycline-inducible mScarlet expressionDepositorInsertTRE-mScarlet; rtTA-T2A-mTagBFP2
UseSynthetic BiologyTagsNLSExpressionMammalianPromoterTRE and CAGAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Sga-Cas9
Plasmid#227005PurposeMammalian expression of Nuclease active S. gallolyticus Cas9DepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLSExpressionMammalianPromoterCMVAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Sin-Cas9
Plasmid#227006PurposeMammalian expression of Nuclease active S. iniae Cas9DepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLSExpressionMammalianPromoterCMVAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Spa-Cas9
Plasmid#227007PurposeMammalian expression of Nuclease active S. parasanguinis Cas9DepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLSExpressionMammalianPromoterCMVAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Sub-Cas9
Plasmid#227008PurposeMammalian expression of Nuclease active S. uberis Cas9DepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLSExpressionMammalianPromoterCMVAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-Cas9-FCPF
Plasmid#220132PurposeExpresses Cas9-FCPF in E.coliDepositorAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-rTetR(SE)-KRAB-2A-mTurquoise
Plasmid#225690PurposeLentiviral expression of rTetR(SE) fused to ZNF10 KRAB and mTurquoise-NLSDepositorInsertrTetR-ZNF10 KRAB
UseLentiviral and Synthetic BiologyTags3xFLAG and T2A-mTurquoiseExpressionMammalianAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB3668
Plasmid#215243PurposeTU for the expression of mAID (N-tag): AcrIIA4 w/o NLS protein Codon optimized for N. benthamiana expression under the regulation of the 35S promoter and TNOS terminatorDepositorInsertP35S:mAID:AcrIIA4:TNOS
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB1531
Plasmid#215242PurposeTU for constitutive expression of Streptomyces phage phiC31 integrase. Catalyzes site-specific recombination between phiC31 attB and attP sites. Contains SV40 NLS. N. benthamiana codon optimized.DepositorInsertPNos:PhiC31:TNos
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKL2-138
Plasmid#219413PurposeEstradiol-inducible expression of 42-10 Zinc finger activatorDepositorInsert{pTEF1-ZEV}{pGal1(Zif268op)x6-3xFLAG-NLS-VP16-mRuby2-(42-10-4x)-PDZLigWT-tSSA1}
ExpressionYeastMutationFour Arg to Ala mutations in zinc finger backboneAvailable SinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQ262F-ABE8e
Plasmid#199179PurposeGateway entry clone (attL1 & attR5) for CRISPR-zSpCas9 ABE8e-HF mediated A-G base editingDepositorInsertABE8e(V106W)-zSpCas9(D10A)
UseCRISPR; Gateway compatible abe8e(v106w)-zspcas9(d…TagsNLSExpressionPlantAvailable SinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSmart-EF1alpha-NlaCas7-p65
Plasmid#207394PurposeExpresses NlaCas7-p65 activator fusion in mammalian cellsDepositorInsertEF1a-NlaCas7-p65-bGH polyA
TagsHA and NLSExpressionMammalianPromoterEF1aAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENmRFPCNAL2 pc1054
Plasmid#167567PurposeThe fusion protein contains a SV40 NLS followed by mRFP, linker and human PCNA.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQ265N1
Plasmid#173998PurposeGateway entry clone (attL1 & attR5) rAPOBEC1-zCas9(D10A)-UNG for C-G base editingDepositorInsertrAPOBEC1-zCas9(D10A)-UNG
UseCRISPRTags3X FLAG, NLSExpressionPlantMutationD10AAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ265O1
Plasmid#173999PurposeGateway entry clone (attL1 & attR5) rAPOBEC1-zCas9(D10A)-rXRCC1 for C-G base editingDepositorInsertrAPOBEC1-zCas9(D10A)-rXRCC1
UseCRISPRTags3X FLAG, NLSExpressionPlantMutationD10AAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
ppBAalbNixE1E3E4 PUb-YFP
Plasmid#173666Purposetransgenesis vector for Aedes albopictus ectopic expression of the Nix geneDepositorInsertsNix masculinisation gene
YFP
TagsSV40 NLSExpressionInsectMutationNix isoforms with exons E1, E3, E4PromoterAedes aegypti PUb and ownAvailable SinceMay 11, 2022AvailabilityAcademic Institutions and Nonprofits only