We narrowed to 13,427 results for: Green Fluorescent Protein
-
Plasmid#63559PurposeExpression of the Mostaza (yellow) spectral variant of eGFP in bacteria and in mammalian cells. Used as a reporter for gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(Y203)
UseLentiviralTagsHis6 and T7ExpressionBacterial and MammalianMutationChanged threonine at position 203 with respect to…PromoterCMV-EF1α hybrid (CEF)Available sinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
JBL6416
Plasmid#183853PurposesfGFP reporter under the control of Mutant E. coli thiB TPP Riboswitch under the control of a Constitutive promoterDepositorInsertE. coli thiB TPP Riboswitch Randomized B nt95-99 regulated sfGFP
ExpressionBacterialPromoterJ23119 - Anderson PromoterAvailable sinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
JBL6418
Plasmid#183855PurposesfGFP reporter under the control of Mutant E. coli thiB TPP Riboswitch under the control of a Constitutive promoterDepositorInsertE. coli thiB TPP Riboswitch Randomized B nt90-94 regulated sfGFP
ExpressionBacterialPromoterJ23119 - Anderson PromoterAvailable sinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
SAGA018
Plasmid#240767PurposePlasmid contains the triple selection cassette gfp - tetApBR322-ROP- CmTrunc that allows for in vivo recombineering in E.coli.DepositorInsertSAGA pBR322-ROP PrhaBAD BCD_low - gfp - tetApBR322-ROP- CmTrunc
UseSynthetic BiologyMutationMutation on translation initiation region of tetAAvailable sinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
SAGA009
Plasmid#240758PurposePlasmid contains the triple selection cassette gfp - tetApBR322-ROP- CmTrunc that allows for in vivo recombineering in E.coli.DepositorInsertSAGA pBR322-ROP J23100 BCD_high - gfp - tetApBR322-ROP- CmTrunc
UseSynthetic BiologyMutationMutation on translation initiation region of tetAAvailable sinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
SAGA007
Plasmid#240756PurposePlasmid contains the triple selection cassette gfp - tetApBR322-ROP- CmTrunc that allows for in vivo recombineering in E.coli.DepositorInsertSAGA pBR322-ROP J23100 BCD_low - gfp - tetApBR322-ROP- CmTrunc
UseSynthetic BiologyMutationMutation on translation initiation region of tetAAvailable sinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-TRIP12(749-836)-EGFP
Plasmid#196229PurposeEGFP fused to the C-terminus of a WWE domain within TRIP12 & a hygromycin resistance cassetteDepositorInsertC-terminal EGFP tagged TRIP12(749- 836)
UseLentiviralTagsEGFP and Myc tagExpressionMammalianPromoterEF1AAvailable sinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-DTX2(8-97)-EGFP
Plasmid#196230PurposeEGFP fused to the C-terminus of first WWE domain within Deltex2 & a hygromycin resistance cassetteDepositorInsertC-terminal EGFP tagged DTX2(8-97)
UseLentiviralTagsEGFP and Myc tagExpressionMammalianPromoterEF1AAvailable sinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-Af1521(K35E/Y145R)-EGFP
Plasmid#196235PurposeEGFP fused to the C-terminus of Af1521(K35E/Y145R) macrodomain & a hygromycin resistance cassetteDepositorInsertC-terminal EGFP tagged Af1521(K35E/Y145R)
UseLentiviralTagsEGFPExpressionMammalianMutationK35E and Y145RPromoterEF1AAvailable sinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRnc2-gGFP
Plasmid#189563PurposeExpresses E. Coli RNase III under control of pBAD promoter with native 5' untranslated region and constitutively expresses gUTR-129-GFPDepositorInsertsRNase III
gUTR-129-GFP
ExpressionBacterialMutationMaintains 5' UTR of rncPromoterJ23119 and pBADAvailable sinceMarch 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRnc-gGFP129
Plasmid#189537PurposeExpresses E. Coli RNase III under control of pBAD promoter and constitutively expresses gUTR-129-GFPDepositorInsertsRNase III
gUTR-129-GFP
ExpressionBacterialMutationN/APromoterJ23119 and pBADAvailable sinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMP71-mGFP-LLO-hPMEL
Plasmid#174607Purposeexpresses palmitoylated GFP with a C terminal fusion of the LLO190 epitope and the human hPMEL epitopeDepositorInsertexpresses palmitoylated GFP w/C-term fusion of the LLO190 epitope and human hPMEL epitope
ExpressionMammalianAvailable sinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
FH95pUG+p97W (B8)
Plasmid#74017Purposelentiviral expression of Psd95 shRNA, and EGFP-SAP97beta fusionDepositorPublicationInsertPsd95 shRNA
UseLentiviral and RNAiExpressionMammalianPromoterH1Available sinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available sinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMVS102_P3-GFP-NATMX6
Plasmid#99048PurposeEGFP reporter with six binding sites for the Zif268 DNA binding domainDepositorInsertsMcIsaac 2014 P3 promoter
eGFP
clonNAT resistance
ExpressionYeastMutationGAL1 promoter with 4 GAL4 sites removed and repla…PromoterMcIsaac 2014 P3 promoterAvailable sinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
bfloGFPc1a
Plasmid#60750PurposeBacterial expression of Amphioxus GFPc1DepositorInsertGFPc1
Tags8xHISExpressionBacterialPromoterT7Available sinceDec. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTM-BPL
Plasmid#173766PurposeFluorescent labeling of the nuclear envelopeDepositorInsertPDGF receptor TM domain, Biotin protein ligase
TagsFLAG and Signal peptideExpressionMammalianPromoterCMVAvailable sinceSept. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBCCP-GFP-NLS
Plasmid#173923PurposeFluorescent labeling of the nuclear envelopeDepositorInsertBiotin carboxyl carrier protein, AcGFP1
Tags3xNLSExpressionMammalianPromoterCMVAvailable sinceSept. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pStrep-1xEGFP-N1
Plasmid#122488PurposeExpression of Strep-tagged 1xEGFPDepositorInsertStrep-tagged 1xEGFP
ExpressionMammalianPromoterCMVAvailable sinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
Gamillus
Plasmid#197926PurposeMonomer expression vectorDepositorInsertGamillus
ExpressionMammalianMutationnoneAvailable sinceNov. 13, 2023AvailabilityAcademic Institutions and Nonprofits only