We narrowed to 7,998 results for: ALP
-
Plasmid#76929Purpose3rd generation lentiviral gRNA plasmid targeting human CAMK2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pDONR223_PPP2R1A_p.R258H
Plasmid#81581PurposeGateway Donor vector containing PPP2R1A , part of the Target Accelerator Plasmid Collection.DepositorInsertPPP2R1A (PPP2R1A Human)
UseGateway entry vectorMutationR258H; p.588_589delLA-insRLPromoterNoneAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_PIK3R1_WT
Plasmid#81748PurposeGateway Donor vector containing PIK3R1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PIK3R1-E160*
Plasmid#116586PurposeLentiviral expression of PIK3R1 E160*DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
GP1BB
Plasmid#51908PurposeExpresses full-length Platelet glycoprotein Ib beta chain precursor ectodomain in mammalian cells. Stop codon before C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertGP1BB (GP1BB Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianMutationStop Codon at amino acid 149, before CD4, bio and…PromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
PAK1 gRNA (BRDN0001145958)
Plasmid#76464Purpose3rd generation lentiviral gRNA plasmid targeting human PAK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAMK2A gRNA (BRDN0001149531)
Plasmid#76928Purpose3rd generation lentiviral gRNA plasmid targeting human CAMK2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFB-EF1a-DIO-Rpl22l1-3xFLAG-2A-GFP
Plasmid#245377PurposeCre-dependent expression of FLAG-tagged Rpl22l1 and EGFP.DepositorAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOET3-6xHis-hSMSr-ΔSAMD
Plasmid#236225PurposeExpress N-terminal His-tagged human SMSr (SAMD8)-sterile alpha motif domain deletion mutant protein in insect cellsDepositorInsertSAMD8 (SAMD8 Human)
TagsHexa histidine tag (6xHis-tag) and enterokinase s…ExpressionInsectMutationsterile alpha motif domain at N-terminal (1-231 b…Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-DGKδ2
Plasmid#226506PurposeExpress N-terminal three tandem FLAG epitope tags, followed by an enterokinase cleavage site and human DGKD geneDepositorInsertDGKD (DGKD Human)
TagsThree tandem FLAG epitope tag and enterokinase cl…ExpressionMammalianPromoterCMVAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
HA-MAP4K4-10A
Plasmid#229403PurposeLentiviral or overpexression of cDNADepositorInsertMAP4K4 (MAP4K4 Human)
UseLentiviralTagsHAExpressionMammalianMutationMARK2 phosphosites (S523,S536,S547,S643,T684,S726…PromoterEFSAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MAP4K4-10D
Plasmid#229404PurposeLentiviral or overpexression of cDNADepositorInsertMAP4K4 (MAP4K4 Human)
UseLentiviralTagsHAExpressionMammalianMutationMARK2 phosphosites (S523,S536,S547,S643,T684,S726…PromoterEFSAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCA528 IST1 L328D (316-366)(C-Cys)
Plasmid#193035PurposeBacterial expression plasmid for IST1 (316-366) with C-terminal Cysteine for fluorescence polarization binding assays. Contains L328D mutation that diminishes binding to MIT domains.DepositorInsertIST1 (IST1 Human)
Tags6xHis-SumoExpressionBacterialMutationL328D, Residues 316-366, Non-native C-terminal Cy…PromoterT7Available SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCA528 IST1 L355A (316-366)(C-Cys)
Plasmid#193036PurposeBacterial expression plasmid for IST1 (316-366) with C-terminal Cysteine for fluorescence polarization binding assays. Contains L355A mutation that diminishes binding to MIT domains.DepositorInsertIST1 (IST1 Human)
Tags6xHis-SumoExpressionBacterialMutationL355A, Residues 316-366, Non-native C-terminal Cy…PromoterT7Available SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
SFFV-RORA-Brd 206
Plasmid#219160PurposeTranscription factor RORA with a specific barcode assigned.DepositorInsertRORA (RORA Human)
UseLentiviralMutationCodon optimizedPromoterThe spleen focus-forming virus (SFFV) promoterAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK zeta mouse
Plasmid#224577PurposeNegative Control for downregulation of the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgPet-1-hSyn-mCherry-KASH
Plasmid#223227PurposeguideRNA targeting the mouse Pet-1 (Fev)DepositorInsertFev (Fev Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
mTph2p(330bp)-mut1-Luc
Plasmid#223664PurposeFirefly-luciferase reporter expression driven by proximal 330-bp of mouse Tph2 promoter point mutation at RRE site 1DepositorInsertmTph2 promoter (Tph2 Mouse)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianPromotermTph2 promoterAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
mTph2p(330bp)-mut2-Luc
Plasmid#223665PurposeFirefly-luciferase reporter expression driven by proximal 330-bp of mouse Tph2 promoter point mutation at RRE site 2DepositorInsertmTph2 promoter (Tph2 Mouse)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianPromotermTph2 promoterAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only