We narrowed to 5,990 results for: org
-
Plasmid#106330PurposeMammalian expression of mutant osteopontinDepositorInsertOPNc (SPP1 Human)
ExpressionMammalianMutationOPNc phosphorylation site mutant SGSSEEKQNAVSSEET…Available SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cas9m3-VP64
Plasmid#47318PurposeCas9m3 ActivatorDepositorInsertCas9m3-VP64
UseCRISPRAvailable SinceAug. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pT7-stl
Plasmid#51721Purposeconditional gene knockdowns in Trypanosoma bruceiDepositorTypeEmpty backboneUseConditional gene knockdown in t. bruceiPromoterT7 (2X)Available SinceMarch 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-ST1-A
Plasmid#48665PurposeBacterial ST1 repression YFP reporter: protospacer ADepositorInsertST1 prototspacer A/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TB
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-ST1-B
Plasmid#48662PurposeBacterial ST1 repression YFP reporter: protospacer BDepositorInsertST1 prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDRF1 Cyterm-mGold
Plasmid#224084PurposeExpresses Cyterm-mGold to check for monomericity.DepositorInsertCyterm-mGold
ExpressionYeastAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
PTGR-PS2-SpyTAG
Plasmid#237443PurposeExpressing PS2 (SpyTAG) S-layer from C. glutamicum under its native promoterDepositorInsertcpsB-SpyTAG
TagsSpyTAGExpressionBacterialAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaNL
Plasmid#216911PurposeMega' with knockout of GvpN and GvpLDepositorInsertMega' with knockout of GvpN and GvpL
ExpressionBacterialAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaRLS
Plasmid#216955PurposeMega' with knockout of GvpR, GvpL and GvpSDepositorInsertMega' with knockout of GvpR, GvpL and GvpS
ExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaLT
Plasmid#216933PurposeMega' with knockout of GvpL and GvpTDepositorInsertMega' with knockout of GvpL and GvpT
ExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaJU
Plasmid#216943PurposeMega' with knockout of GvpJ and GvpUDepositorInsertMega' with knockout of GvpJ and GvpU
ExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaKJ
Plasmid#216939PurposeMega' with knockout of GvpK and GvpJDepositorInsertMega' with knockout of GvpK and GvpJ
ExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaLSK
Plasmid#216957PurposeMega' with knockout of GvpL, GvpS and GvpKDepositorInsertMega' with knockout of GvpL, GvpS and GvpK
ExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaLS
Plasmid#216930PurposeMega' with knockout of GvpL and GvpSDepositorInsertMega' with knockout of GvpL and GvpS
ExpressionBacterialAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaRS
Plasmid#216904PurposeMega' with knockout of GvpR and GvpSDepositorInsertMega' with knockout of GvpR and GvpS
ExpressionBacterialAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaB
Plasmid#216879PurposeMega' with knockout of GvpBDepositorInsertMega' with knockout of GvpB
ExpressionBacterialAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaRN
Plasmid#216900PurposeMega' with knockout of GvpR and GvpFDepositorInsertMega' with knockout of GvpR and GvpF
ExpressionBacterialAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaKU
Plasmid#216941PurposeMega' with knockout of GvpK and GvpUDepositorInsertMega' with knockout of GvpK and GvpU
ExpressionBacterialAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only