We narrowed to 4,977 results for: IRES
-
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMIG-hNFATc2/C(1-686, RIT)FLAG-AVITEV
Plasmid#74055Purposeretroviral expression plasmid for human NFATc2/C(1-686, RIT) (without C-terminal region, with RIT mutation abrogating AP1 binding) with C-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc2, isoform C (NFATC2 AS 1-686 (N terminus deleted), Human)
UseRetroviralTagsAVI-TEV and FLAGExpressionMammalianMutationsilent mutation A1723C in the sequence of NM_1730…Available SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
RF15
Bacterial Strain#102799PurposeBL21(DE3)-based E. coli amino acid auxotrophic host strain used for selective isotope labeling. aspC tyrB trpA trpB glyA serB genes deleted.DepositorBacterial ResistanceNoneAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.iGluSnFr.WPRE.SV40 (AAV9)
Viral Prep#98929-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.hSyn.iGluSnFr.WPRE.SV40 (#98929). In addition to the viral particles, you will also receive purified pAAV.hSyn.iGluSnFr.WPRE.SV40 plasmid DNA. Synapsin-driven, iGluSnFr glutamate sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 (AAV1)
Viral Prep#98930-AAV1PurposeReady-to-use AAV1 particles produced from pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 (#98930). In addition to the viral particles, you will also receive purified pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 plasmid DNA. GFAP-driven glutamate sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterGFAPAvailable SinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.iGluSnFr.WPRE.SV40 (AAV5)
Viral Prep#98929-AAV5PurposeReady-to-use AAV5 particles produced from pAAV.hSyn.iGluSnFr.WPRE.SV40 (#98929). In addition to the viral particles, you will also receive purified pAAV.hSyn.iGluSnFr.WPRE.SV40 plasmid DNA. Synapsin-driven, iGluSnFr glutamate sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceFeb. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 (AAV9)
Viral Prep#98930-AAV9PurposeReady-to-use AAV9 particles produced from pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 (#98930). In addition to the viral particles, you will also receive purified pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 plasmid DNA. GFAP-driven glutamate sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterGFAPAvailable SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 (AAV5)
Viral Prep#98930-AAV5PurposeReady-to-use AAV5 particles produced from pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 (#98930). In addition to the viral particles, you will also receive purified pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 plasmid DNA. GFAP-driven glutamate sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterGFAPAvailable SinceFeb. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.iGluSnFr.WPRE.SV40 (AAV1)
Viral Prep#98929-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.hSyn.iGluSnFr.WPRE.SV40 (#98929). In addition to the viral particles, you will also receive purified pAAV.hSyn.iGluSnFr.WPRE.SV40 plasmid DNA. Synapsin-driven, iGluSnFr glutamate sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceFeb. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40 (AAV9)
Viral Prep#98931-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40 (#98931). In addition to the viral particles, you will also receive purified pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40 plasmid DNA. Synapsin-driven, Cre-dependent, iGluSnFr glutamate sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40 (AAV1)
Viral Prep#98931-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40 (#98931). In addition to the viral particles, you will also receive purified pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40 plasmid DNA. Synapsin-driven, Cre-dependent, iGluSnFr glutamate sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 (AAV5)
Viral Prep#98932-AAV5PurposeReady-to-use AAV5 particles produced from pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 (#98932). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent glutamate sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40 (AAV5)
Viral Prep#98931-AAV5PurposeReady-to-use AAV5 particles produced from pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40 (#98931). In addition to the viral particles, you will also receive purified pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40 plasmid DNA. Synapsin-driven, Cre-dependent, iGluSnFr glutamate sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 (AAV1)
Viral Prep#98932-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 (#98932). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent glutamate sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 (AAV9)
Viral Prep#98932-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 (#98932). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent glutamate sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_NE1m (AAV9)
Viral Prep#123308-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_NE1m (#123308). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_NE1m plasmid DNA. Synapsin-driven expression of GRAB-NE1m norepinephrine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_NE1h (AAV9)
Viral Prep#123309-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_NE1h (#123309). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_NE1h plasmid DNA. hSyn-driven expression of GRAB-NE1h norepinephrine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMarch 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_NEmut (AAV9)
Viral Prep#123310-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_NEmut (#123310). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_NEmut plasmid DNA. hSyn-driven expression of GRAB-NEmut control norepinephrine sensor (does not respond to NE). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_NE1m (AAV Retrograde)
Viral Prep#123308-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-hSyn-GRAB_NE1m (#123308). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_NE1m plasmid DNA. Synapsin-driven expression of GRAB-NE1 norepinephrine sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 4, 2019AvailabilityAcademic Institutions and Nonprofits only