We narrowed to 9,228 results for: pcr
-
Plasmid#141248PurposePCR cloned Phaeodactylum tricornutum Mitochondrial Genome - Clone 1DepositorPublicationInsertReduced Mitochondrial Genome of Phaeodactylum tricornutum
UseSynthetic Biology; Diatom expressionExpressionBacterial and YeastMutationRepeat region removed, additional minor mutations…Available sinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR-Blunt_mWasabi
Plasmid#112640PurposePlasmid for PCR amplification of mWasabi DNA template for in vitro transcriptionDepositorInsertmWasabi
UsePcr templatePromoterT7Available sinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPT-PCR C1
Plasmid#141248PurposePCR cloned Phaeodactylum tricornutum Mitochondrial Genome - Clone 1DepositorPublicationInsertReduced Mitochondrial Genome of Phaeodactylum tricornutum
UseSynthetic Biology; Diatom expressionExpressionBacterial and YeastMutationRepeat region removed, additional minor mutations…Available sinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR-Blunt_mWasabi
Plasmid#112640PurposePlasmid for PCR amplification of mWasabi DNA template for in vitro transcriptionDepositorInsertmWasabi
UsePcr templatePromoterT7Available sinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1-INS-904
Plasmid#53970Purpose904 bp insert from human INS gene used as a control for methylation-specific PCR assaysDepositorAvailable sinceJuly 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
JI401: Ad5 E1A/Hexon qRT-PCR standard
Plasmid#131753PurposePlasmid standard containing regions of the Ad5 E1A and Ad5 Hexon genes to create a qRT-PCR standard curve for detection of replication competent adenovirus (RCA).DepositorInsertsAd5 E1A gene fragment
Ad5 Hexon gene fragment
UseStandard for qrt-pcrPromoterN/AAvailable sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1-INS-904
Plasmid#53970Purpose904 bp insert from human INS gene used as a control for methylation-specific PCR assaysDepositorAvailable sinceJuly 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
Yeast GPCR-sensor Toolkit
Plasmid kit#1000000157PurposeThis toolkit includes plasmids for constructing highly-tunable GPCR-based biosensors in yeast.DepositorApplicationCloning and Synthetic Biology, Gene Expression and LabelingVector typeYeast ExpressionCloning typeGolden Gate (MoClo)Available sinceOct. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1-Ins2-842
Plasmid#53969Purpose842 bp insert from mouse Ins2 gene used as a control for methylation-specific PCR assaysDepositorAvailable sinceJuly 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
JI401: Ad5 E1A/Hexon qRT-PCR standard
Plasmid#131753PurposePlasmid standard containing regions of the Ad5 E1A and Ad5 Hexon genes to create a qRT-PCR standard curve for detection of replication competent adenovirus (RCA).DepositorInsertsAd5 E1A gene fragment
Ad5 Hexon gene fragment
UseStandard for qrt-pcrPromoterN/AAvailable sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1311
Plasmid#61254PurposeTemplate for cloning sgRNA(F+E) to generate new PU6::sgRNAs by PCR-fusionDepositorInsertsgRNA(F+E) targeting Y61A9L9.1
UseCRISPR; Cloning templateAvailable sinceDec. 18, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCR2.1-Ins2-842
Plasmid#53969Purpose842 bp insert from mouse Ins2 gene used as a control for methylation-specific PCR assaysDepositorAvailable sinceJuly 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJW1311
Plasmid#61254PurposeTemplate for cloning sgRNA(F+E) to generate new PU6::sgRNAs by PCR-fusionDepositorInsertsgRNA(F+E) targeting Y61A9L9.1
UseCRISPR; Cloning templateAvailable sinceDec. 18, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCBC-MT1T2
Plasmid#50593PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT1, gRNA scaffold, OsU3t plus, TaU3p, T2
UseCRISPR; Pcr templateExpressionPlantAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJW1310
Plasmid#61253PurposeTemplate for cloning U6 promoter to generate new PU6::sgRNAs by PCR-fusionDepositorInsertU6 promoter
UseCRISPR; Cloning templateAvailable sinceDec. 18, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEPkan-S
Plasmid#41017PurposePCR template for en passant (two-step Red-mediated) mutagenesisDepositorInsertKana_I-SceI
Available sinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCBC-MT1T2
Plasmid#50593PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT1, gRNA scaffold, OsU3t plus, TaU3p, T2
UseCRISPR; Pcr templateExpressionPlantAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBP-T7RNAP
Plasmid#74096PurposeT7 RNA polymerase PCR cloned from BL21 (DE3) genomic DNADepositorPublicationInsertT7 RNAP
UseSynthetic BiologyExpressionBacterialPromoterNoneAvailable sinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only