We narrowed to 6,132 results for: cat.2
-
Plasmid#144747PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertEBF3 (EBF3 Human)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterEF1aAvailable sinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-NONO 40
Plasmid#127653PurposeKnock-out of human NONODepositorInsertNONO sgRNA (NONO Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
TFORF0301
Plasmid#141569PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertCREM (CREM Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cav2.1 EIVA (E1707A) pcDNA3
Plasmid#206125Purposeexpression of rat Cav2.1 calcium channel with a E1686R mutation to enhance expression and a mutation in the P loop of Domain IV to to abolish divalent cation bindingDepositorInsertcacna1a (Cacna1a Rat)
UseTagsExpressionMammalianMutationE1707APromoterCMVAvailable sinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cav2.1 HA EIA (E320A) pcDNA3
Plasmid#206124Purposeexpression of rat Cav2.1 calcium channel with a E1686R mutation to enhance expression and a mutation in the P loop of Domain I to abolish divalent cation bindingDepositorInsertcacna1a (Cacna1a Rat)
UseTagsExpressionMammalianMutationE320APromoterCMVAvailable sinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0304
Plasmid#141572PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertCREM (CREM Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0298
Plasmid#141566PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertCREM (CREM Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0315
Plasmid#141580PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertCREM (CREM Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0313
Plasmid#141578PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertCREM (CREM Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0312
Plasmid#141577PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertCREM (CREM Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0309
Plasmid#141575PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertCREM (CREM Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0311
Plasmid#141576PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertCREM (CREM Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0308
Plasmid#141574PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertCREM (CREM Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0305
Plasmid#141573PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertCREM (CREM Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0303
Plasmid#141571PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertCREM (CREM Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0302
Plasmid#141570PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertCREM (CREM Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0300
Plasmid#141568PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertCREM (CREM Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0299
Plasmid#141567PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertCREM (CREM Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDRM56 tet-AR(1-707)C617Y
Plasmid#183504PurposeLentiviral vector expressing a doxycycline-inducible truncated DNA-binding mutant androgen receptor (AR mutant C617Y)DepositorInsertAndrogen receptor (AR Human)
UseLentiviralTagsExpressionMammalianMutationTruncated mutant AR; spans AR 1-707 aa, and conta…PromoterCMVAvailable sinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3ExpressionMutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…PromoterAvailable sinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only