We narrowed to 8,876 results for: sgrna
-
Plasmid#230908PurposeDouble inducible expression of Cas12a+ with Gal4 and Flp.DepositorInsertCas12a+
UseCRISPRExpressionInsectAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-PLK4
Plasmid#227310PurposeExpresses SpCas9 and a sgRNA targeting the C-terminus of PLK4 for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
p8270 LentiCRISPR v2 hygro sgSIGIRR-3
Plasmid#193979PurposeExpression of spCas9 and sgRNA targeting SIGIRRDepositorInsertspCas9 and sgRNA targeting SIGIRR (SIGIRR Human)
UseLentiviralAvailable SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP8921
Plasmid#220903PurposeMobileCRiSPRi test system encoded on a kanR Tn7 transposon; mScarlet-I, PD-sgRNA (BsaI site), and PC-dCas9-novoDepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840AAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP8932
Plasmid#220906PurposeMobileCRiSPRi system encoded on a kanR Tn7 transposon; PD-sgRNA (BsaI site) and PG-dCas9-novo (for cloning new guides)DepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840AAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
hLig4 guide2 in pX458
Plasmid#211536PurposesgRNA-2 against Lig4DepositorAvailable SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hLig4 guide1 in pX458
Plasmid#211535PurposesgRNA-1 against Lig4DepositorAvailable SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-TC9
Plasmid#202088Purposeentry vector for gateway recombination of TevCas9 and sgRNA into a destination cassette in pCitro-destDepositorInsertTevCas9 + sgRNA cassette
UseCRISPRAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
p8271 LentiCRISPR v2 hygro sgSIGIRR-4
Plasmid#193980PurposeExpression of spCas9 and sgRNA targeting SIGIRRDepositorInsertspCas9 and sgRNA targeting SIGIRR (SIGIRR Human)
UseLentiviralAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only