We narrowed to 7,855 results for: Trac
-
Plasmid#220628PurposePlasmid allows you to place the RNA sequence of interest next to two MS2 coat protein recognition sites.DepositorTypeEmpty backboneExpressionYeastAvailable SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pENTR_TiTRE
Plasmid#172128PurposeEntry vector for tightly controlled gene expression by a tetracycline-responsive promoterDepositorTypeEmpty backboneUseGateway CloningExpressionMammalianPromotertight TREAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hARAF-shRNA-1
Plasmid#185370PurposeFor tetracycline-inducible mammalian expression of shRNA: GCCGTGACCAGATTATCTTTA that targets human ARAFDepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBTM116-D9
Plasmid#111232Purposeyeast expression vectorDepositorInsertccdB-cassette
ExpressionYeastAvailable SinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pROSA26-ZtTA
Plasmid#26082DepositorInserta loxP-flanked β-geo preceding the tetracycline transactivator tTA
UseMouse TargetingAvailable SinceNov. 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCDW114
Plasmid#70061Purposeartificial transcription template "wild-type"DepositorInsertlambda PR' - repeat cassette - E. coli rpoB - lambda TR'
Available SinceJan. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDW115
Plasmid#70062Purposeartificial transcription template "pause ablation"DepositorInsertlambda PR' A+2G T+6G - repeat cassette - E. coli rpoB - lambda TR'
Available SinceJan. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQHD
Plasmid#48102PurposeDestination plasmid (Gateway cloning) for cumate-inducible expression of HA-tagged fusion proteinDepositorTypeEmpty backboneTagsHA tagExpressionBacterialPromoterPQ5Available SinceJan. 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
xfz3N/pCS2+
Plasmid#16328DepositorInsertfrizzled-3 (fzd3.L Frog)
UseVertebrate expressionMutationExtracellular ligand binding domain of Xenopus fr…Available SinceDec. 21, 2007AvailabilityAcademic Institutions and Nonprofits only -
pQFD
Plasmid#48101PurposeDestination plasmid (Gateway cloning) for cumate-inducible expression of 3xFLAG-tagged fusion proteinDepositorTypeEmpty backboneTags3xFLAGExpressionBacterialPromoterPQ5Available SinceJan. 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
pQYD
Plasmid#48104PurposeDestination plasmid (Gateway cloning) for cumate-inducible expression of SYFP2-tagged fusion proteinDepositorTypeEmpty backboneTagsSYFP2ExpressionBacterialPromoterPQ5Available SinceJan. 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
xfz2N/pCS2+
Plasmid#16329DepositorInsertfrizzled-2 (fzd2 Frog)
UseVertebrate expressionMutationExtracellular ligand binding domain of Xenopus fr…Available SinceDec. 21, 2007AvailabilityAcademic Institutions and Nonprofits only -
DEXsynth:3xhA-ccdb + RUBY
Plasmid#233318PurposeGATEWAY compatible vector with a dexamethasone (DEX)-inducible promoter driving in frame epitope fusion of 3xHA tag paired with ccdb selection toxin and RUBY markerDepositorInsertDEXsynth:3xhA-ccdb + RUBY
UseGateway CloningTags3xHAAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
DEXsynth:3xhA-ccdb + mcherry
Plasmid#233313PurposeGATEWAY compatible vector with a dexamethasone (DEX)-inducible promoter driving in frame epitope fusion of 3xHA tag paired with ccdb selection toxin and mCherry markerDepositorInsertDEXsynth:3xhA-ccdb + mcherry
UseGateway CloningTags3xHAAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ubi:3xHA-ccdb + mcherry
Plasmid#233301PurposeGATEWAY compatible vector with a soybean Ubiquitin (GmUbi) promoter driving in frame epitope fusion of 3xHA tag paired with ccdb selection toxin and mCherry markerDepositorInsertUbi:3xHA-ccdb + mcherry
UseGateway CloningTags3xHAAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGLU_63
Plasmid#225766PurposeThis is the native promoter from the tetL tetracycline resistance cassette.DepositorInsertPtetL_[abr]
UseSynthetic BiologyMutationN/AAvailable SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmPop2a-D53AE55A-dsRNAres-V5His6_K
Plasmid#146718PurposeInsect Expression of DmPop2a-D53AE55A-dsRNAresDepositorInsertDmPop2a-D53AE55A-dsRNAres (Pop2 Fly)
ExpressionInsectMutationORF extracted from CG5684-Pa; NM_140281.2, with o…Available SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
CDW116
Plasmid#129687Purposetranscription template, scrambled promoterDepositorInsertsynthetic transcription template
ExpressionBacterialAvailable SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZV_21_400
Plasmid#170477PurposeTo amplify transcription template containing LacI operatorsDepositorInsertT7A1, O2, O1, Lambda t1 in lacZ fragment
ExpressionBacterialPromoterT7A1Available SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMin1
Plasmid#102959PurposeMini-transposon system suitable for sequencing, shuttle mutagenesis and gene fusionsDepositorTypeEmpty backboneUseMini-transposon system suitable for sequencing, s…Available SinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only