We narrowed to 6,884 results for: poly
-
Plasmid#226782PurposeExpression of wzxE and other genes from the E. coli enterobacterial common antigen biosynthesis gene clusterDepositorInsertwzxE, wecF, wzyE, wecG
ExpressionBacterialPromoterBADAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTag4C_AVPR1A-V2R-NTEV-tcs-GV
Plasmid#227102PurposeAVPR1A receptor for split TEV assayDepositorInsertAVPR1A-NTEV (AVPR1A Human)
ExpressionMammalianAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTag4C_ADRA1A-V2R-NTEV-tcs-GV
Plasmid#227101PurposeADRA1A receptor for split TEV assayDepositorInsertADRA1A-NTEV (ADRA1A Human)
ExpressionMammalianAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_GR-RE_MLPmin_BC1093-luc2
Plasmid#227113PurposeGlucocorticoid receptor response element for luciferase and barcode assays; barcode BC1093DepositorInsert12x clustered GR response element linked to MLP minimal promoter driving barcode 1093 and a luciferase reporter gene
UseAAVExpressionMammalianAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK_Gal4-DBD-ESR1
Plasmid#227099PurposeESR1 receptor overexpression for luciferase and barcode assaysDepositorInsertESR1 (ESR1 Human)
ExpressionMammalianAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-CUP1-His6-CUbo(K48R/K63R)-GFP
Plasmid#212795PurposeCopper-inducible expression of the artificial test substrate His6-CUbo(K48R/K63R)-GFP in budding yeastDepositorInsertHis6-CUbo(K48R/K63R)-GFP
UseIntegrative vectorExpressionYeastMutationCUb(K48R/K63R)PromoterCUP1Available SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pegRNA entry vector - pUC19-U6-[BsmBI_entry]-term (MNW320)
Plasmid#208977PurposeEntry vector for human U6 promoter driven SpCas9-based pegRNAs, comprised of hU6-[BsmBI]-terminator (spacer and RTT/PBS oligos must be cloned in)DepositorInsertpUC19-U6-[BsmBI]-term (pegRNA_entry_vector)
UseCRISPRTagsBPNLSExpressionMammalianPromoterhuman U6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_S172A_M173A RAD23A
Plasmid#201574PurposeExpresses a variant of human RAD23A containing mutations S172A and M173A within UBA1. Variant of plasmid pCMV6-AN-DDK_WT RAD23ADepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
TagsFLAGExpressionMammalianMutationContains mutations S172A and M173AAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_V195A RAD23A
Plasmid#201575PurposeExpresses a variant of human RAD23A containing mutation V195A within UBA1. Variant of plasmid pCMV6-AN-DDK_WT RAD23ADepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
TagsFLAGExpressionMammalianMutationContains mutation V195AAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_C344A RAD23A
Plasmid#201577PurposeExpresses a variant of human RAD23A containing mutation C344A within UBA2. Variant of plasmid pCMV6-AN-DDK_WT RAD23ADepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
TagsFLAGExpressionMammalianMutationContains mutation C344AAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_F354A RAD23A
Plasmid#201578PurposeExpresses a variant of human RAD23A containing mutation F354A within UBA2. Variant of plasmid pCMV6-AN-DDK_WT RAD23ADepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
TagsFLAGExpressionMammalianMutationContains mutation F354AAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_C344A_F354A RAD23A
Plasmid#201579PurposeExpresses a variant of human RAD23A containing mutations C344A and F354A within UBA2. Variant of plasmid pCMV6-AN-DDK_WT RAD23ADepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
TagsFLAGExpressionMammalianMutationContains mutations C344A and F354AAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT RAD23B_delta aa 276-339 (delta XPC-binding domain)
Plasmid#201547PurposeExpresses a mutant form of human RAD23B that lacks the XPC-binding domain. Variant of plasmid pCMV6-AN-DDK_WT RAD23BDepositorInsertUV excision repair protein RAD23 homolog B (RAD23B Human)
TagsFLAGExpressionMammalianMutationLacks residues 276-339Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19-TdTc253
Plasmid#207464PurposeBacterial expression of Terminal deoxynucleotidyl transferase (TdT) cysteine variant. Only one surface-exposed cysteine, at residue 253DepositorInsertMTdTc253 (Dntt Mouse)
Tags10xHisExpressionBacterialMutationSer253Cys, Cys188Ala, Cys216Ser, Cys302Ala, Cys37…Available SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19-TdTc188
Plasmid#207463PurposeBacterial expression of Terminal deoxynucleotidyl transferase (TdT) cysteine variant. Only one surface-exposed cysteine, at residue 188DepositorInsertTdTc188 (Dntt Mouse)
Tags10xHisExpressionBacterialMutationCys216Ser, Cys302Ala, Cys378Ala, and Cys438SerAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19-TdTc180
Plasmid#207462PurposeBacterial expression of Terminal deoxynucleotidyl transferase (TdT) cysteine variant. Only one surface-exposed cysteine, at residue 180DepositorInsertTdTc180 (Dntt Mouse)
Tags10xHisExpressionBacterialMutationGlu180Cys, Cys188Ala, Cys216Ser, Cys302Ala, Cys37…Available SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19-TdTc302
Plasmid#207461PurposeBacterial expression of Terminal deoxynucleotidyl transferase (TdT) cysteine variant. Only one surface-exposed cysteine, at residue 302DepositorInsertTdTc302 (Dntt Mouse)
Tags10xHisExpressionBacterialMutationCys188Ala, Cys216Ser, Cys378Ala, and Cys438SerAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRR-C421-G2304D
Plasmid#182845Purposemutation G2304D (GGC/GAC), PCR product coding C-terminal residues 2011-2431 of TRR was inserted into modified pGEX-2T by Nde I-Nsi I sitesDepositorAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRX-C751-E3616S
Plasmid#182844Purposemutation E3616S (GAA/TCA), PCR product coding C-terminal residues 2976-3726 of TRX was inserted into modified pGEX-2T by Nde I-Nsi I sites. Expression in E. coli. by IPTG inductionDepositorAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only