We narrowed to 17,731 results for: aav
-
Plasmid#223148PurposeExpression of truncated MECP2 with dCjCas9 and empty gRNA scaffoldDepositorInsertMECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310PromoterEF1aAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DO-ChroME2f-ST-P2A-GCaMP8s
Plasmid#227786PurposeCre off - Cation channelrhodopsin ChroME2f fused to GCaMP8m and targeted to the neuronal soma and proximal dendritesDepositorInsertDO-ChroME2f-ST-P2A-GCaMP8s
UseAAVExpressionMammalianAvailable SinceJan. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DO-ChroME2f-ST-P2A-GCaMP8s
Plasmid#227786PurposeCre off - Cation channelrhodopsin ChroME2f fused to GCaMP8m and targeted to the neuronal soma and proximal dendritesDepositorInsertDO-ChroME2f-ST-P2A-GCaMP8s
UseAAVExpressionMammalianAvailable SinceJan. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON HaloTag-Jph3 WPRE
Plasmid#236238PurposeAAV expression of human Junctophilin3 N-terminally tagged with HaloTagDepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON HaloTag-Jph3 WPRE
Plasmid#236238PurposeAAV expression of human Junctophilin3 N-terminally tagged with HaloTagDepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRmine-oScarlet-KV 2.1-WPRE
Plasmid#183519PurposeOptogeneticsDepositorHas ServiceAAV8InsertChRmine-oScarlet-Kv2.1
UseAAVPromoterCaMKIIaAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRmine-oScarlet-KV 2.1-WPRE
Plasmid#183519PurposeOptogeneticsDepositorHas ServiceAAV8InsertChRmine-oScarlet-Kv2.1
UseAAVPromoterCaMKIIaAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Jaws-KGC-GFP-ER2
Plasmid#99233PurposeAAV-mediated expression of Jaws-KGC-GFP-ER2 under the CAG promoter. Using bGH pA signal.DepositorInsertJaws-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationK200R W214FPromoterCAGAvailable SinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Jaws-KGC-GFP-ER2
Plasmid#99233PurposeAAV-mediated expression of Jaws-KGC-GFP-ER2 under the CAG promoter. Using bGH pA signal.DepositorInsertJaws-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationK200R W214FPromoterCAGAvailable SinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_eCBmut
Plasmid#164605PurposeExpress the endocannabinoid non-responsive sensor GRAB_eCBmut in neuronsDepositorInsertEndocannabinoid non-responsive sensor GRAB_eCBmut
UseAAVMutationS383T, F177APromoterhSynAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_eCBmut
Plasmid#164605PurposeExpress the endocannabinoid non-responsive sensor GRAB_eCBmut in neuronsDepositorInsertEndocannabinoid non-responsive sensor GRAB_eCBmut
UseAAVMutationS383T, F177APromoterhSynAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.iGluSnFR3.v857.SGZ
Plasmid#178337PurposeFluorescent reporter for glutamate, third generation, variant 857 in Stargazin (SGZ) backbone. iGluSnFR3.v857.SGZDepositorInsertpAAV GFAP iGluSnFR3 v857.SGZ
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and Stargazin and PDZ dom…ExpressionMammalianAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.iGluSnFR3.v857.SGZ
Plasmid#178337PurposeFluorescent reporter for glutamate, third generation, variant 857 in Stargazin (SGZ) backbone. iGluSnFR3.v857.SGZDepositorInsertpAAV GFAP iGluSnFR3 v857.SGZ
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and Stargazin and PDZ dom…ExpressionMammalianAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.EF1a.eGFP.WPRE.rBG (AAV2)
Viral Prep#105547-AAV2PurposeReady-to-use AAV2 particles produced from pENN.AAV.EF1a.eGFP.WPRE.rBG (#105547). In addition to the viral particles, you will also receive purified pENN.AAV.EF1a.eGFP.WPRE.rBG plasmid DNA. EF1a-driven EGFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEGFPAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.EF1a.eGFP.WPRE.rBG (AAV2)
Viral Prep#105547-AAV2PurposeReady-to-use AAV2 particles produced from pENN.AAV.EF1a.eGFP.WPRE.rBG (#105547). In addition to the viral particles, you will also receive purified pENN.AAV.EF1a.eGFP.WPRE.rBG plasmid DNA. EF1a-driven EGFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEGFPAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV pEF1a-DIO-FLPo-WPRE-hGHpA (AAV2)
Viral Prep#87306-AAV2PurposeReady-to-use AAV2 particles produced from AAV pEF1a-DIO-FLPo-WPRE-hGHpA (#87306). In addition to the viral particles, you will also receive purified AAV pEF1a-DIO-FLPo-WPRE-hGHpA plasmid DNA. EF1a-driven, Cre dependent expression of the site-specific recombinase FlpO. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV pEF1a-DIO-FLPo-WPRE-hGHpA (AAV2)
Viral Prep#87306-AAV2PurposeReady-to-use AAV2 particles produced from AAV pEF1a-DIO-FLPo-WPRE-hGHpA (#87306). In addition to the viral particles, you will also receive purified AAV pEF1a-DIO-FLPo-WPRE-hGHpA plasmid DNA. EF1a-driven, Cre dependent expression of the site-specific recombinase FlpO. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1h (AAV Retrograde)
Viral Prep#113050-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-hSyn-GRAB_DA1h (#113050). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_DA1h plasmid DNA. Synapsin-driven expression of GRAB-DA1h dopamine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1h (AAV Retrograde)
Viral Prep#113050-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-hSyn-GRAB_DA1h (#113050). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_DA1h plasmid DNA. Synapsin-driven expression of GRAB-DA1h dopamine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-CoChR-Kv2.1-GP2A-NLS-eGFP
Plasmid#253381PurposeCre-dependent, soma-targeted CoChR with nuclear GFP expressionDepositorInsertst-CoChR-GP2A-NLS-eGFP
UseAAVExpressionMammalianAvailable SinceMay 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-CoChR-Kv2.1-GP2A-NLS-eGFP
Plasmid#253381PurposeCre-dependent, soma-targeted CoChR with nuclear GFP expressionDepositorInsertst-CoChR-GP2A-NLS-eGFP
UseAAVExpressionMammalianAvailable SinceMay 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-NanoLuc-15aa linker-βarrestin2-HA-GS linker-TEVp
Plasmid#125228PurposeExpresses SPARK2 NanoLuc-βarrestin2-TEVp in mammalian cellsDepositorInsertNanoLuc-15aa linker-βarrestin2-HA-GS linker-TEVp
UseAAVTagsHAExpressionMammalianPromoterCMVAvailable SinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-NanoLuc-15aa linker-βarrestin2-HA-GS linker-TEVp
Plasmid#125228PurposeExpresses SPARK2 NanoLuc-βarrestin2-TEVp in mammalian cellsDepositorInsertNanoLuc-15aa linker-βarrestin2-HA-GS linker-TEVp
UseAAVTagsHAExpressionMammalianPromoterCMVAvailable SinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-LAP2-mCherry
Plasmid#159524PurposeExpresses mCherry from LAP2 promoterDepositorInsertmCherry
UseAAVExpressionMammalianPromoterLAP2Available SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-LAP2-mCherry
Plasmid#159524PurposeExpresses mCherry from LAP2 promoterDepositorInsertmCherry
UseAAVExpressionMammalianPromoterLAP2Available SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1
Plasmid#190902PurposeAAV vector expressing thew GFP reporter gene and human sgHTTDepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1
Plasmid#190902PurposeAAV vector expressing thew GFP reporter gene and human sgHTTDepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MPRA-MluI-SpeI-EcoRI
Plasmid#190196PurposeEmpty vector for inserting MPRA libraries into AAVDepositorTypeEmpty backboneUseAAV; Massively parallel reporter assay (mpra)ExpressionMammalianAvailable SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only