We narrowed to 15,166 results for: aga
-
-
-
SGEP-sh-Hs-PHGDH-67
Plasmid#188671PurposeshRNADepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgSik1_1st-hU6-sgSik3_1st
Plasmid#177216PurposeExpresses a Sik3-targeting and a non-targeting gRNAs and Cre-recombinaseDepositorInsertsgSik1_1st/sgSik3_1st
UseLentiviralPromotermU6/hU6Available SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgSik3_1st-hU6-sgNT
Plasmid#177214PurposeExpresses a Sik3-targeting and a non-targeting gRNAs and Cre-recombinaseDepositorInsertsgSik3_1st/sgNT1
UseLentiviralPromotermU6/hU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
SGEP-sh-Hs-PHGDH-1968
Plasmid#188673PurposeshRNADepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
SGEP-sh-Hs-PHGDH-1967
Plasmid#188672PurposeshRNADepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgSik1_2nd-hU6-sgNT
Plasmid#177213PurposeExpresses a Sik1-targeting (mU6) and a non-targeting (hU6) gRNAs and Cre recombinaseDepositorInsertsgSik1_2nd/sgNT1
UseLentiviralPromotermU6/hU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZNF3.1.0-gDNA
Plasmid#132440PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF3 (ZNF3 Human)
UseCRISPRAvailable SinceDec. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHACK-GAL4>GAL80
Plasmid#104874PurposeHACK Donor plasmids for converting GAL4 lines to GAL80 lines using HACK method.DepositorInsertT2A-GAL80
UseCRISPRExpressionInsectAvailable SinceMarch 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Pi21
Plasmid#126904PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHnS 2comp Donor;smFP-V5 KO;Gphn#1
Plasmid#240307PurposeDonor:smFP-V5 KO:Gphn#1DepositorInsertKO gRNAs for Gphn
UseAAVMutationNAAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
CRISPR plasmid
Plasmid#236553PurposeEncodes Cas9 and two guideRNAs, one to cut the genome downstream of HSPA5 (BiP/GRP78) and one to linearize the DONOR plasmid.DepositorInsertCas9
ExpressionMammalianAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Blast_HP1beta_gRNA
Plasmid#127908PurposeWT Cas9 Vector with Blasticidin Selection Marker targeting the 5' end of the human HP1beta geneDepositorInsertgRNA for Human 5' HP1beta
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ Pi21
Plasmid#126892PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ WRKY28_2
Plasmid#126900PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJK138
Plasmid#73314PurposePas2p peroxisomal membrane targeting sequenceDepositorInsertPas2p (peroxisomal membrane targeting region)
TagsHis6 and c-mycExpressionYeastMutationencodes residues 1-42PromoterAOX1Available SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GR-GECO1.2
Plasmid#42187DepositorInsertGR-GECO1.2
PromoterCMVAvailable SinceFeb. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgSik1_1st-mU6-sgSik2-hU6-sgSik3_1st
Plasmid#177232PurposeExpresses Sik1(bU6), Sik2 (mU6) and Sik3 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgSik1_1st/sgSik2/sgSik3_1st
UseLentiviralPromoterbU6/mU6/hU6Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only