We narrowed to 9,445 results for: Pol
-
Plasmid#175797Purposede novo thick circular tandem repeat protein capped to prevent multimerizationDepositorInserttcTRP24sub8_Cap
Tags6xHisExpressionBacterialAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
SH2-free
Plasmid#175800PurposeHuman Nck2 SH2 domainDepositorInserthuman Nck2 SH2
Tags6xHisExpressionBacterialAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
tcTRP9
Plasmid#175793Purposede novo thick circular tandem repeat proteins with 9 repeatsDepositorInserttcTRP9
Tags6xHisExpressionBacterialAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
UBC1cer40GEM
Plasmid#172699PurposeUbiquitous expression of 60meric GEM monomerDepositorInsertmonomer of 60mer GEM
UseUnspecifiedTagsGFPExpressionPlantPromoterUBC1Available SinceAug. 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBAD-DiB1
Plasmid#168800PurposeFluorogen activating protein (FAP) DiB1DepositorInsertFluorogen activating protein DiB1
TagsHis-tagExpressionBacterialPromoteraraBADAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBAD-DiB3
Plasmid#168802PurposeFluorogen activating protein (FAP) DiB3DepositorInsertFluorogen activating protein DiB3
TagsHis-tagExpressionBacterialPromoteraraBADAvailable SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLyGo-Ec-2
Plasmid#163128PurposepLyGo cloning vector for periplasmic expression in E. coli of a sequence of interest (LPMO). Vector encoding MalE signal peptide and the LyGo cassette (SapI-ccdB-SapI)DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialPromoterT7Available SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP3
Plasmid#113974PurposeSingle short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFP.R373
Plasmid#138243PurposeExpresses the split mCherry reporter interrupted by the SaP-dpol intein (in cis)DepositorInsertsUseSynthetic BiologyTags6xHisExpressionBacterialPromoterP(araBAD) and iPCAvailable SinceJuly 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBz106_CsoS2_MR
Plasmid#140843PurposeHis-tagged CsoS2 Middle Region (MR), pET-14b backboneDepositorInsertCsoS2 Middle Region (MR)
TagsHexahistidine tagExpressionBacterialMutationonly amino acids 257-603PromoterT7Available SinceJune 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLz75_CB_operon_CsoS2_N3-N4
Plasmid#140857PurposeSame as pLz37 but with CsoS2 truncated such that NTD repeats N1 and N2 are removedDepositorInsertCbbL, CbbS, CsoS2 (delN1-N2), CsoSCA, CsoS4A, CsoS4B, CsoS1C, CsoS1A, CsoS1B, CsoS1D
ExpressionBacterialMutationdeleted amino acids 1-109 of CsoS2Available SinceJune 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLz77_CB_operon_CsoS2_N3
Plasmid#140859PurposeSame as pLz37 but with CsoS2 discontinuously truncated such that repeats N1, N2, and N4 are removedDepositorInsertCbbL, CbbS, CsoS2 (delN1-N2, N4), CsoSCA, CsoS4A, CsoS4B, CsoS1C, CsoS1A, CsoS1B, CsoS1D
ExpressionBacterialMutationdeleted amino acids 1-108 and 220-235 of CsoS2Available SinceJune 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLz78_CB_operon_CsoS2_delNTD
Plasmid#140860PurposeSame as pLz37 but with CsoS2 truncated to remove the entire NTD (i.e. N1, N2, N3, and N4 are removed)DepositorInsertCbbL, CbbS, CsoS2 (delNTD), CsoSCA, CsoS4A, CsoS4B, CsoS1C, CsoS1A, CsoS1B, CsoS1D
ExpressionBacterialMutationdeleted amino acids 1-235 of CsoS2Available SinceJune 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLz76_CB_operon_CsoS2_N4
Plasmid#140858PurposeSame as pLz37 but with CsoS2 truncated such that NTD repeats N1, N2, and N3 are removedDepositorInsertCbbL, CbbS, CsoS2 (delN1-N3), CsoSCA, CsoS4A, CsoS4B, CsoS1C, CsoS1A, CsoS1B, CsoS1D
ExpressionBacterialMutationdeleted amino acids 1-189 of CsoS2Available SinceJune 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBz109_CsoS2_NTD
Plasmid#140842PurposeHis-tagged CsoS2 N-terminal domain (NTD), pET-14b backboneDepositorInsertCsoS2 N-terminal domain (NTD)
TagsHexahistidine tagExpressionBacterialMutationdeleted amino acids 262-869PromoterT7Available SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg1
Plasmid#113966PurposeSingle short guide RNA targeting GTATAGCATACATTATACGDepositorInsertsg1
PromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBz110_CsoS2_CTD
Plasmid#140844PurposeHis-tagged CsoS2 C-terminal domain (CTD), pET-14b backboneDepositorInsertCsoS2 C-terminal domain (CTD)
TagsHexahistidine tagExpressionBacterialMutationdeleted amino acids 1-594PromoterT7Available SinceMay 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKM136
Plasmid#134177PurposeBacterial expression of his-CENP-C 700-943DepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only