We narrowed to 38,228 results for: NAM
-
Plasmid#87848PurposepCR2.1-based plasmid holding a 328-bp fragment containing the exon-1-exon-2 splice border of aberrant HBB[IVSI-110(G>A)] human β-globin mRNADepositorInsertHomo sapiens hemoglobin subunit beta (HBB), Aberrant cDNA fragment (Exon1/19nt mispliced Intron1 + Exon2) (HBB Human)
ExpressionBacterialMutationHBB(IVSI-110) β-thalassaemia misplicing mutation …Available SinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLENTI_Hu_ECT2(T327D)
Plasmid#136332PurposeLentiviral expression of human ECT2_T327DDepositorAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEJS1099: Dual-sgRNA.Design 4
Plasmid#159537PurposeDelivery of dual sgRNA cassettes and Nme2Cas9 in a single AAV vectorDepositorInsertNme2Cas9 with two guide RNA cassettes
UseAAV, CRISPR, and Mouse TargetingTagsNLSExpressionMammalianPromoterU1aAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ERBB2-V5/HIS
Plasmid#201103Purposeexpression of human ERBB2 receptor tyrosine kinase in mammalian cellsDepositorInserthuman ERBB2 receptor tyrosine kinase, full length, wildtype (ERBB2 Human)
TagsV5/HisExpressionMammalianPromoterCMVAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
MSCV-ASNS-OE-IRES-Thy1.1
Plasmid#192947PurposeAsparagine synthetase overexpression in murine cellsDepositorAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-EGFP-PARP1
Plasmid#176146PurposeEGFP fused to the N-terminus of PARP1 & a hygromycin resistance cassetteDepositorInsertPoly(ADP-Ribose) Polymerase 1 (PARP1 Human)
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS1089: mini-AAV.sgRNA.Nme2Cas9
Plasmid#159536PurposeDelivery of Nme2Cas9 and its sgRNA in a single AAV vector with overall packaging size of 4.4 KbDepositorInsertNme2Cas9 with single guide RNA cassette
UseAAV, CRISPR, and Mouse TargetingTagsNLSExpressionMammalianPromoterU1aAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFBOH-MHL.RING1B
Plasmid#224712PurposeExpresses N-terminal hexahistidine-tagged human RING1B (RNF2) in insect cells.DepositorAvailable SinceOct. 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
ρ1-EM GABAA receptor in pEZT-BM
Plasmid#213072PurposeExpress human GABA-A rho1 receptor with truncated intracellular domain and superfolder GFP insertion in ICDDepositorInsertHuman GABAa rho1 receptor (GABRR1 Human)
UseBacmam, baculovirus, oocyte expressionTagsTwin-Strep tag and superfolderGFPExpressionMammalianMutationEncodes residues S58–L383 and D451–S479, separate…PromoterCMV and T7Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN4-ires-puro
Plasmid#167828PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN4
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-GW
Plasmid#60323PurposeThis is a modified version of the pGL4.23 vector from Promega, containing a Gateway cassette upstream of the minimal promoter. This vector can be used for for Gateway cloning of candidate enhancer elements. As negative control, use pGL4.23 without the gateway cassette (available from Promega).DepositorTypeEmpty backboneUseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN5-ires-puro
Plasmid#167821PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN5
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H187
Plasmid#170348PurposemT2Del_EPACdDEPCD_Q270E_tdcp173Ven(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_Q270E_tdcp173Ven(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJuly 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FGFR1c-V5/HIS
Plasmid#201106Purposeexpression of human FGFR1 receptor tyrosine kinase in mammalian cellsDepositorInserthuman FGFR1 receptor tyrosine kinase, variant c, full length, wildtype (FGFR1 Human)
TagsV5/HisExpressionMammalianPromoterCMVAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FLT3-D835Y-V5/HIS
Plasmid#236007Purposeexpression of the D835Y kinase defective mutant variant of human FLT3 that is associated with Acute Myeloid Leukemia and Acute Lymphoblastic LeukemiaDepositorInserthuman FLT3-D835Y receptor tyrosine kinase, full length (FLT3 Human)
TagsV5/HisExpressionMammalianMutationD835Y substitutionPromoterCMVAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-RAP1A-WT-puro
Plasmid#156166PurposeLentiviral vector for expression of RAP1A-WT, with puromycin selectionDepositorInsertRAP1A (RAP1A Human)
UseLentiviralTagsnoneExpressionMammalianMutationwild type formPromoterhuman PGKAvailable SinceJuly 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-RAP1A-E63-puro
Plasmid#156167PurposeLentiviral vector for expression of RAP1A-E63, with puromycin selectionDepositorInsertRAP1A (RAP1A Human)
UseLentiviralTagsnoneExpressionMammalianMutationchanged Glutamine 63 to Glutamic acidPromoterhuman PGKAvailable SinceJuly 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEJS1096 Dual-sgRNA.Design 1
Plasmid#159538PurposeDelivery of dual sgRNA cassettes and Nme2Cas9 in a single AAV vectorDepositorInsertNme2Cas9 nuclease with two guide RNA cassettes with promoters
UseAAV, CRISPR, and Mouse TargetingTagsNLSExpressionMammalianPromoterU1aAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only