We narrowed to 38,613 results for: NAM
-
Plasmid#166134PurposeThis plasmid allows efficient KO of the firefly luciferase gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting firefly luciferase gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-CMVtight-PLXNB2 iOE
Plasmid#176849Purposelentiviral vector for doxycycline-inducible PLXNB2 overexpressionDepositorAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-hPLXNB2_PGK_Neo
Plasmid#176848Purposelentiviral vector for constitutive PLXNB2 overexpressionDepositorAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
SITS-Cavin4a-mCherry
Plasmid#176022PurposeLeishmania cell free expression of zebrafish Cavin4a-mCherry. Parton lab clone GWUDepositorAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
SITS-Cavin4a-EGFP
Plasmid#176018PurposeLeishmania cell free expression of zebrafish Cavin4a-EGFP. Parton lab clone GRKDepositorInsertCavin4a (cavin4a Zebrafish)
UseLeishmania cell free expressionAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV ShadowY-AURKA K162M-mTurq2
Plasmid#157771PurposeExpression of AuroraA kinase-dead biosensor under CMV promoterDepositorInsertAURKA (AURKA Human)
TagsmTurquoise2 and shadowYExpressionMammalianMutationAURKA K162M is a kinase-dead version of AURKAPromoterCMVAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGK-Ptrf-mKate2
Plasmid#128765PurposeFluorescent mKate reporter for PtrfDepositorAvailable SinceNov. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1_HBB_A
Plasmid#87848PurposepCR2.1-based plasmid holding a 328-bp fragment containing the exon-1-exon-2 splice border of aberrant HBB[IVSI-110(G>A)] human β-globin mRNADepositorInsertHomo sapiens hemoglobin subunit beta (HBB), Aberrant cDNA fragment (Exon1/19nt mispliced Intron1 + Exon2) (HBB Human)
ExpressionBacterialMutationHBB(IVSI-110) β-thalassaemia misplicing mutation …Available SinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLENTI_Hu_ECT2(T327D)
Plasmid#136332PurposeLentiviral expression of human ECT2_T327DDepositorAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
miniTol2 x EF1a_EKAREN5 + PGK-blast
Plasmid#167818PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN5
Tagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FGFR1c-V5/HIS
Plasmid#201106Purposeexpression of human FGFR1 receptor tyrosine kinase in mammalian cellsDepositorInserthuman FGFR1 receptor tyrosine kinase, variant c, full length, wildtype (FGFR1 Human)
TagsV5/HisExpressionMammalianPromoterCMVAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-DDR1-F866Y-V5/HIS
Plasmid#236009Purposeexpression of the F866Y kinase defective mutant variant of human DDR1 that might be associated with lung AdenocarcinomaDepositorInserthuman DDR1-F866Y receptor tyrosine kinase, full length (DDR1 Human)
TagsV5/HisExpressionMammalianMutationF866Y substitutionPromoterCMVAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ERBB2-V5/HIS
Plasmid#201103Purposeexpression of human ERBB2 receptor tyrosine kinase in mammalian cellsDepositorInserthuman ERBB2 receptor tyrosine kinase, full length, wildtype (ERBB2 Human)
TagsV5/HisExpressionMammalianPromoterCMVAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN5-ires-puro
Plasmid#167821PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN5
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-GW
Plasmid#60323PurposeThis is a modified version of the pGL4.23 vector from Promega, containing a Gateway cassette upstream of the minimal promoter. This vector can be used for for Gateway cloning of candidate enhancer elements. As negative control, use pGL4.23 without the gateway cassette (available from Promega).DepositorTypeEmpty backboneUseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H187
Plasmid#170348PurposemT2Del_EPACdDEPCD_Q270E_tdcp173Ven(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_Q270E_tdcp173Ven(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJuly 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEJS1099: Dual-sgRNA.Design 4
Plasmid#159537PurposeDelivery of dual sgRNA cassettes and Nme2Cas9 in a single AAV vectorDepositorInsertNme2Cas9 with two guide RNA cassettes
UseAAV, CRISPR, and Mouse TargetingTagsNLSExpressionMammalianPromoterU1aAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7 FLAG-YAP1-TEAD-P-H2B-mCherry
Plasmid#128327PurposeReporter to evaluate YAP1/TEAD-mediated gene transcriptionDepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only