We narrowed to 8,386 results for: Dos
-
Plasmid#248008PurposeExpression of synthetic Kemp eliminase (Des27.13)DepositorInsertKE-Des27.13
Tags12xHis-bdSumoExpressionBacterialPromoterT7Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pESC-leu2D-LjCPR1-GW
Plasmid#233735PurposeExpresses plant cytochrome P450 in yeast for enzyme assay. Contains CPR1 from Lotus japonicusDepositorTypeEmpty backboneExpressionYeastPromoterGal 1 and Gal 10Available SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZmSWEET13a:ZmSWEET13a:GUS
Plasmid#159535Purposeexpresses ß--glucuronidase in cells expressing ZmSWEET13aDepositorInsertZmSWEET13a
TagsGUSExpressionBacterial and PlantPromoternative SWEET13a promoterAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOET3-6xHis-hSMSr
Plasmid#236224PurposeExpress N-terminal His-tagged human SMSr (SAMD8) protein in insect cellsDepositorInsertSAMD8 (SAMD8 Human)
TagsHexa histidine tag (6xHis-tag) and enterokinase s…ExpressionInsectMutationwild typeAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α-loxP-GCaMP6f-loxP-WPRE
Plasmid#233288PurposeAAV vector with EF1α promoter and Cre-Out GCaMP6f, enabling to express GCaMP6f in Cre-negative cells.DepositorInsertGCaMP6f
UseAAVPromoterEF1αAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGYL17_pPromALB_enhALB_FireflyLuc
Plasmid#220283PurposeFirefly luciferase with minimal Albumin promoter with a 380 nt, -10.5 kb mouse Alb enhancer cloned into KpnI/XhoI-digested pPromALB_FireflyLucDepositorInsertAlb Enhancer
UseLuciferasePromoterminimal albumin promoterAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDIV302
Plasmid#204973PurposeAMA1 plasmid with Aspergillus optimized Mad7 and nat1 resistance markerDepositorInsertsMad7
nat1
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus nidulans tef1 promoter and Aspergillu…Available SinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV299
Plasmid#204967PurposeAMA1 plasmid with Aspergillus optimized Mad7 and argB selection markerDepositorInsertsMad7
argB
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus nidulans tef1 promoter and native pro…Available SinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap V1
Plasmid#226538PurposeBacterial expression of N-terminally 6His tagged A1-LCD V1DepositorInsertA1-LCD swap V1
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap V2
Plasmid#226539PurposeBacterial expression of N-terminally 6His tagged A1-LCD V2DepositorInsertA1-LCD swap V2
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap V3
Plasmid#226540PurposeBacterial expression of N-terminally 6His tagged A1-LCD V3DepositorInsertA1-LCD swap V3
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X5
Plasmid#226547PurposeBacterial expression of N-terminally 6His tagged A1-LCD X5DepositorInsertA1-LCD swap X5
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X7
Plasmid#226549PurposeBacterial expression of N-terminally 6His tagged A1-LCD X7DepositorInsertA1-LCD swap X7
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X1
Plasmid#226543PurposeBacterial expression of N-terminally 6His tagged A1-LCD X1DepositorInsertA1-LCD swap X1
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap V5
Plasmid#226542PurposeBacterial expression of N-terminally 6His tagged A1-LCD V5DepositorInsertA1-LCD swap V5
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only