We narrowed to 11,954 results for: CAD
-
Plasmid#227012PurposeLentiviral Expression of dCas9-KRAB from S. uberis fused to the repressive KRAB domainDepositorInsertdCas9
UseCRISPR and LentiviralTags3xFLAG, SV40 NLSPromoterUbCAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL655
Plasmid#231165PurposeT-DNA encoding gRNA targeting SlPDSDepositorInsertgRNA targeting SlPDS
ExpressionPlantPromoterAtU6Available SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
MZB224
Plasmid#226998PurposeBacterial expression of 10xHis-SUMO (Smt3) fusion to HRV-3C cleavable Halotagged Arf (T31N) for pulldown assaysDepositorInsertArf1 (ARF1 Human)
Tags10x His, HaloTag, and SUMO (SMT3)ExpressionBacterialMutationT31NPromoterT7Available SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
MZB220
Plasmid#221771PurposeBacterial expression of human Arl1 (Q71L) with C-terminal 'self-cleaving' CPD-10xHis tagDepositorAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
MZB222
Plasmid#221772PurposeBacterial expression of 10xHis-SUMO (Smt3) fusion to Sec7 domain (687-885) of Big1 (ArfGEF1) for rapid nucleotide exchange and activation of Arf GTPasesDepositorAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL562
Plasmid#231162PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlCHL1DepositorInsertmobile gRNA targeting SlCHL1
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEE834
Plasmid#231168PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlPDSDepositorInsertmobile gRNA targeting SlPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
ZFPL1-GFP
Plasmid#224590PurposeFor expression of ZFPL1-GFP in mammalian cellsDepositorAvailable SinceDec. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
FAM177A1-SNAP
Plasmid#224592PurposeFor expression of FAM177A1-SNAPTag in mammalian cellsDepositorAvailable SinceDec. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHsp70(K71E)-GFP
Plasmid#228196Purposeexpressed human Hsp70 (K71E mutation) with a GFP fluorescent protein tagDepositorAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTE5418_pMBP-GlcR
Plasmid#221192PurposeExpression vector for 10x-MBP-GlcR (MGlcR). GlcR is a glycolate-responsive transcriptional repressor and the gene product of pden4400 from Paracoccus denitrificans, codon optimized for E. coli.DepositorInsertglcR (pden4400 from Paracoccus denitrificans)
Tags10x His tag with E. coli maltose binding protein …ExpressionBacterialPromoterT7 promoter and T7 promoter-lacOAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTE5419_p3WJdB-glcO36
Plasmid#221193PurposeGlcR module template with glcO36 operator: T7 promoDNA template of GlcR sensor with glcO36 operator: T7 promoter-glcO36-3WJdB reporter-T7 terminator linear DNA tter-glcO36-3WJdB reporter-T7 terminatorDepositorInsertT7 promoter-glcO36
UseSynthetic BiologyExpressionBacterialPromoterT7 promoter with downstream glcO36 operatorAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET41SIII-ATF6(1-373)
Plasmid#171074PurposeExpresses of ATF6α(1-373) in bacteriaDepositorAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTY186 EGFP-T2A-ALFA-ORF6 SARS-CoV-2
Plasmid#204976PurposeCo-express EGFP and SARS-CoV-2 ORF6 N-terminally labeled with ALFA tagDepositorAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
UCK2_Deletion_gRNA_1
Plasmid#204672PurposeDual gRNA plasmid for UCK2 deletionDepositorAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
UCK2_Deletion_gRNA_2
Plasmid#204673PurposeDual gRNA plasmid for UCK2 deletionDepositorAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL-VinculinTS-S1033A
Plasmid#211835PurposeVinculin tension sensor (VinTS) with vinculin S1033 unphosphorylatable point mutation (S1033A), in lentiviral expression vector.DepositorInsertVinculinTS-S1033A (VCL Synthetic, Chicken)
UseLentiviralMutationmutated vinculin serine 1033 to alanine (S1033A),…PromoterCMVAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL-VinculinTS-S1033D
Plasmid#211893PurposeVinculin tension sensor (VinTS) with vinculin S1033 phosphomimetic point mutation (S1033D), in lentiviral expression vector.DepositorInsertVinculinTS-S1033D (VCL Synthetic, Chicken)
UseLentiviralMutationmutated vinculin serine 1033 to aspartic acid (S1…PromoterCMVAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only