We narrowed to 55,211 results for: Ide
-
Plasmid#122242PurposeExpresses a dominant negative Kash construct that disrupts LINC complexes in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationPromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only
-
FgH1tUTG_huMcl-1.1
Plasmid#85530PurposeInducible expression of guide RNA (huMcl-1.1) with fluorescent GFP reporterDepositorInserthu Mcl-1.1 (MCL1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterH1tAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 puro - CRBN (#2)
Plasmid#166241PurposesgRNA (#2) to generate a knockout of human CRBN by targeting the start region of Exon1DepositorInsertCRBN (CRBN Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceDec. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mkgDUX4mal*leu*
Plasmid#21173DepositorInsertDUX4 (DUX4 Human)
UseTagsExpressionBacterial and MammalianMutationFirst point mutation at nucleotide 5114 (numberin…PromoterAvailable sinceAug. 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX_305-N-dTAG-FRA1
Plasmid#188742Purposeexpresses murine Fosl1 (Fra1) with N-terminal tag FKBP F36V (dTAG) for the dTAG systemDepositorInsertFosl1 (Fosl1 Mouse)
UseLentiviralTagsFKBP F36V tag (dTAG)ExpressionMammalianMutationPromoterhPGK promoterAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSumo24P7vB4
Plasmid#113073PurposePlasmid for highly efficient expression of engineered IL24 with binding affinity to cognate receptorsDepositorInsertHuman IL-24 engineered by computational design and fused with N-terminal SUMO tag (IL24 SUMO part (Brachypodium distachyon), Human)
UseTagsSUMOExpressionBacterialMutationQ60R, K62E, K68E, K77R, M80L, S88D, A89V, Q93R, Q…PromoterT7Available sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSumo24P7
Plasmid#113072PurposePlasmid for highly efficient expression of engineered IL24 with mutated binding sitesDepositorInsertHuman IL-24 engineered by computational design and fused with N-terminal SUMO tag (IL24 SUMO part (Brachypodium distachyon), Human)
UseTagsSUMOExpressionBacterialMutationQ60R, K62E, K68E, K77R, M80L, S88D, A89V, Q93R, Q…PromoterT7Available sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pScaffold-H1 donor
Plasmid#118152PurposePCR template for dual guide RNA cloning, guide RNA scaffold for the Streptococcus pyogenes CRISPR/Cas9 system - H1 promoterDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28 E2 LBD-Tev-E1a-His
Plasmid#232117PurposeFor bacterial expression of a fusion protein containing from N to C-terminus: the lipoyl-binding domain of Human E2, a TEV protease site, a peptide from Human E1a, and a His tag.DepositorInsertDBT (DBT Human)
UseTags6xHis, RIGHHSTSDDSSAY (AA331 to 345 (preprocessin…ExpressionBacterialMutationPromoterT7 PromoterAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpG-HF1-P2A-EGFP (RTW5000)
Plasmid#139996PurposeCMV and T7 promoter expression plasmid for human codon optimized SpG-HF1(SpG=D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R;HF1=N497A/R661A/Q695A/Q926A) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9 variant named SpG-HF1 with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpG=D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R; HF…PromoterCMV and T7Available sinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpRY-P2A-EGFP (RTW4830)
Plasmid#139989PurposeCMV and T7 promoter expression plasmid for human codon optimized SpRY(A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1322R/R1333P/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9 variant named SpRY with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpRY=A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N131…PromoterCMV and T7Available sinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EFS-BirAopt-GSQ-RBXN-P2A-BLAST
Plasmid#208048PurposeEnables constitutive expression of BirAopt alone; RBXN represents a EcoR1-BsiW1-Xba1-Not1 polylinker; to perform bioE3; selection with blasticidinDepositorInsertBirAopt
UseLentiviralTagsExpressionMutationBirAopt is human-codon-optimized BirA (PMID 15707…PromoterEFSAvailable sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas9-Geminin
Plasmid#109401PurposeExpresses Cas9 fusion to Geminin degron domainDepositorInsertGeminin (GMNN Human)
UseTagsExpressionMutationGeminin degron fragmentPromoterAvailable sinceMay 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-Synaptojanin 1-170
Plasmid#22292DepositorInsertSynaptojanin 1_170 (SYNJ1 Human)
UseTagsFlagExpressionBacterial and MammalianMutationK334R compared to Genbank ID NM_003895PromoterAvailable sinceOct. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpRY-HF1-P2A-EGFP (RTW5008)
Plasmid#139997PurposeCMV and T7 promoter expression plasmid for human codon optimized SpRY-HF1(SpRY=A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1322R/R1333P/R1335Q/T1337R;HF1=N497A/R661A/Q695A/Q926A) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9 variant named SpRY-HF1 with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpRY=A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N131…PromoterCMV and T7Available sinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Plxnb2(L)-Fc-His
Plasmid#72128PurposeExpresses the extracellular region of the PlexinB2 protein (ie, long), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertPlxnb2 (Plxnb2 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceMarch 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
AP1muA-TurboID-polyA-G418 HR
Plasmid#227734PurposeHomology repair plasmid for endogenous tagging of AP1muA at the C-terminus with TurboID and a V5 epitope tag. Contains a G418 resistance cassette for selection of edited cells.DepositorInsertgenomic sequence AP1M1 locus (AP1M1 Human)
UseCRISPRTagsTurbo-ID, V5ExpressionMutationPromoterAvailable sinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-HE
Plasmid#109400PurposeExpresses Cas9 fusion to HE (HDR-enhancer) domain of human CtIP proteinDepositorInsertHDR-Enhancer domain of human CtIP protein (RBBP8 Human)
UseTagsExpressionMutationPromoterAvailable sinceJune 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EFS-BirAopt-GSQ-RNF4wt-P2A-BLAST
Plasmid#208046PurposeEnables constitutive expression of N-terminal BirAopt-fused RNF4wt; to perform bioE3; selection with blasticidinDepositorInsertRNF4 (RNF4 Human)
UseLentiviralTagsBirAoptExpressionMutationPromoterEFSAvailable sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only