We narrowed to 525 results for: Tore
-
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_3x_siRNA
Plasmid#59893Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with three siRNA-like sitesDepositorInsertmCherry with intron containing the mouse mir-124–3
UseTagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--has three siRNA-like targets (fully c…Promoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available sinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV-RO1.7-Hsp90ab1-FLAG
Plasmid#206355PurposeAAV plasmid expressing FLAG-tagged HSP90AB1 in photoreceptorsDepositorInsertHsp90ab1 (Hsp90ab1 Mouse)
UseAAVTags3xFLAGExpressionMutationPromoter1.7kb human red opsinAvailable sinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1-MBP-NAAEF-PNR(217-410 C275)-His6
Plasmid#177849PurposeBacterial Expression of PNRDepositorInsertphotoreceptor cell-specific nuclear receptor (NR2E3 Human)
UseTags6xHis and MBPExpressionBacterialMutationPromoterAvailable sinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_d23
Plasmid#59892Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with two seed sites mutatedDepositorInsertmCherry with intron containing the mouse mir-124–3
UseTagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--3rd and fourth seed site removedPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available sinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_d3
Plasmid#59891Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with one seed site mutated.DepositorInsertmCherry with intron containing the mouse mir-124–3
UseTagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--3rd seed site removedPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available sinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV_T7-PE2-Nuclease
Plasmid#171997PurposeSequence provided for PE-Nuclease mRNA transcription, suitable for microinjectionDepositorInsertCMV_T7-Cas9-RT
UseTagsExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable sinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-RRAR/D614G
Plasmid#164570PurposeSARS-CoV-2 Spike protein with D614G mutation and Furin site restored (S-RRAR-D614G variant)DepositorInsertSpike (S-RRAR-D614G variant)
UseTags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianMutationD614GPromoterAvailable sinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-hRedOpsin-fCD200
Plasmid#164425PurposeAAV plasmid expressing full-length CD200 in photoreceptorsDepositorInsertCD200 (Cd200 Mouse)
UseAAVTagsExpressionMammalianMutationPromoterhuman red opsinAvailable sinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease
Plasmid#176528PurposeDelivers all prime editing nuclease components in a single plasmidDepositorInsertCbH-Cas9-RT, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
UseCRISPRTagsExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCbH for Cas9, hU6 for gRNAsAvailable sinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_7x_Bulge
Plasmid#59894Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with seven bulge target sitesDepositorInsertmCherry with intron containing the mouse mir-124–3
UseTagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--has seven bulge targets (fully comple…Promoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available sinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-CDreV
Plasmid#140133Purposecan be used to generate AAV virus that will express fusion protein of split Dre (C-terminal) and fungal photoreceptor Vivid (VVD) monomerDepositorInsertCDreV
UseAAVTagsExpressionMutationPromoterEF1aAvailable sinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV10-Flag-Ovtm
Plasmid#51888Purposeexpression vectore in mammalian cellsDepositorInsertmFbxl3 (Fbxl3 Mouse)
UseTagsFLAGExpressionMammalianMutationovtm (I364T)PromoterCMVAvailable sinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV-hRedOpsin-fCX3CL1
Plasmid#164421PurposeAAV plasmid expressing full-length CX3CL1 (fractalkine) in photoreceptorsDepositorInsertCx3cl1 (Cx3cl1 Mouse)
UseAAVTagsExpressionMammalianMutationPromoterhuman red opsinAvailable sinceJuly 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-Puro
Plasmid#171992PurposeDelivers all prime editing nuclease components in a single, puromycin selectable plasmidDepositorInsertCbH-Cas9-RT-T2A-Puro, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
UseTagsExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable sinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-GFP
Plasmid#171994PurposeDelivers all prime editing nuclease components in a single, GFP selectable plasmidDepositorInsertCbH-Cas9-RT-T2A-GFP, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
UseTagsExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable sinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-CCreV
Plasmid#140132Purposecan be used to generate AAV virus that will express fusion protein of split Cre (C-terminal) and fungal photoreceptor Vivid (VVD) monomerDepositorInsertCCreV
UseAAVTagsExpressionMutationPromoterEF1aAvailable sinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-NCreV
Plasmid#140131Purposecan be used to generate AAV virus that will express fusion protein of split Cre (N-terminal) and fungal photoreceptor Vivid (VVD) monomerDepositorInsertNCreV
UseAAVTagsExpressionMutationPromoterEF1aAvailable sinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDH_CMV_dHMGA_mKate2_CLEAVAGE
Plasmid#167337PurposeExpresses mKate2 fused to TFAM dHMGA mutant in mammalian cellsDepositorInsertTFAM (TFAM Human)
UseLentiviralTagsmKate2ExpressionMammalianMutationTruncation mutant containing MTS (1-42) as well a…PromoterCMVAvailable sinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH_CMV_HMGB_ctail_mKate2_CLEAVAGE
Plasmid#167338PurposeExpresses mKate2 fused to TFAM HMGB+C-tail mutant in mammalian cellsDepositorInsertTFAM (TFAM Human)
UseLentiviralTagsmKate2ExpressionMammalianMutationTruncation mutant containing MTS (1-42) as well a…PromoterCMVAvailable sinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only