We narrowed to 8,908 results for: chloramphenicol
-
Plasmid#206814PurposeTemplate for hlpA-mneongreen amplification associated with chloramphenicol resistance geneDepositorInserthlpA
UseSynthetic BiologyTagsmNeonGreenMutation3insGAvailable sinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
DVC_pBR322_AF
Plasmid#217598PurposeDestination vector with chloramphenicol resistance and pBR322 origin of replication. Carries A-F CIDAR MoClo overhangs for level 1 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyMutationNoneAvailable sinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
DVC_pBR322_AE
Plasmid#217597PurposeDestination vector with chloramphenicol resistance and pBR322 origin of replication. Carries A-E CIDAR MoClo overhangs for level 1 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyMutationNoneAvailable sinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCm No carrier NikJC199U
Plasmid#174361PurposeExpression plasmid with a TEV removable C-term 8xHis Tag and Chloramphenicol resistance. NikJ C199U cloned in the cloning site.DepositorInsertnikJ, nikkomycin biosynthesis protein P1 [Streptomyces tendae]
Tags8xHis and TEVExpressionBacterialMutationC199UPromoterT7Available sinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMXLC_pFa
Plasmid#114219PurposePOC12355, MetClo assembly vector with p15A replication origin and chloramphenicol resistance for BsaI-based MetClo, adaptor sequence type p-aDepositorInsertLacZalpha
UseSynthetic BiologyAvailable sinceFeb. 15, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PM-TD!TB
Plasmid#48656PurposeBacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TB
Plasmid#48652PurposeBacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TB
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRedCm
Plasmid#176225PurposeLambdaRed-expressing plasmid carrying the chloramphenicol acetyltransferase gene repressible by the CI repressor of lambda phageDepositorInsertLambda Red operon under control of PrhaB promoter and cat under control of PL promoter of lambda phage
UseSynthetic BiologyExpressionBacterialPromoterPrhaB and PLAvailable sinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVP076
Plasmid#222028PurposeEmpty spectinomycin resistant GreenGate destination vector based on pGGP-AG. Domesticated of Esp3I sites in the backbone and chloramphenicol resistance gene.DepositorTypeEmpty backboneUseSynthetic Biology; Greengate compatible cloning v…MutationAll Esp3i sites domesticatedAvailable sinceDec. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
PtetA-PLacO3O1 150 bp with pBELO_L6-PT3-T4_CAMR_TAN+
Plasmid#225645PurposetetA and LacO3O1 promoters in tandem conformation with 150bp distance between them, expressing mCherry with pBELO_L6-PT3-T4 backbone and chloramphenicol resistanceDepositorInserttetR/tetA and LacO3O1 in tandem conformation
TagsmCherryExpressionBacterialPromotertetA and LacO3O1 promotersAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLacO3O1-PtetA 250 bp with pBELO_L6-PT3-T4_CAMR_TAN+
Plasmid#225648PurposeLacO3O1 and tetA promoters in tandem conformation with 250bp distance between them, expressing mCherry with pBELO_L6-PT3-T4 backbone and chloramphenicol resistanceDepositorInsertLacO3O1 and tetR/tetA in tandem conformation
TagsmCherryExpressionBacterialPromoterLacO3O1 and tetA promotersAvailable sinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLacO3O1-PtetA 150 bp with pBELO_L6-PT3-T4_CAMR_TAN+
Plasmid#225647PurposeLacO3O1 and tetA promoters in tandem conformation with 150bp distance between them, expressing mCherry with pBELO_L6-PT3-T4 backbone and chloramphenicol resistanceDepositorInsertLacO3O1 and tetR/tetA in tandem conformation
TagsmCherryExpressionBacterialPromoterLacO3O1 and tetA promotersAvailable sinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
PtetA-PLacO3O1 350 bp with pBELO_L6-PT3-T4_CAMR_TAN+
Plasmid#225646PurposetetA and LacO3O1 promoters in tandem conformation with 350bp distance between them, expressing mCherry with pBELO_L6-PT3-T4 backbone and chloramphenicol resistanceDepositorInserttetR/tetA and LacO3O1 in tandem conformation
TagsmCherryExpressionBacterialPromotertetA and LacO3O1 promotersAvailable sinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCm N-term SMT3 NikJC199U
Plasmid#174210PurposeExpression plasmid with a TEV removable C-term 8xHis Tag, an N-term SUMO tag and Chloramphenicol resistance. NikJ C199U cloned in the cloning site.DepositorInsertnikJ, nikkomycin biosynthesis protein P1 [Streptomyces tendae]
Tags8xHis, SMT3, and TEVExpressionBacterialMutationC199UPromoterT7Available sinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCm C-term SMT3 NikJC199U
Plasmid#174362PurposeExpression plasmid with a TEV removable C-term 8xHis Tagged SUMO tag, and Chloramphenicol resistance. NikJ C199U cloned in the cloning site.DepositorInsertnikJ, nikkomycin biosynthesis protein P1 [Streptomyces tendae]
Tags8xHis, SMT3, and TEVExpressionBacterialMutationC199UPromoterT7Available sinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRedCmOcr
Plasmid#176226PurposeA helper plasmid for expression of the artificial T7ocr-gam-bet-exo operon. The plasmid carries the chloramphenicol acetyltransferase gene repressible by the CI repressor of lambda phage.DepositorInsertLambda Red-T7ocr operon under control of PrhaB promoter and cat under control of PL promoter of lambda phage
UseSynthetic BiologyExpressionBacterialPromoterPrhaB and PLAvailable sinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
DVC_p15A_EF
Plasmid#217589PurposeDestination vector with chloramphenicol resistance and p15A origin of replication. Carries E-F CIDAR MoClo overhangs for level 1 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyMutationNoneAvailable sinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
DVC_pBR322_FG
Plasmid#217600PurposeDestination vector with chloramphenicol resistance and pBR322 origin of replication. Carries F-G CIDAR MoClo overhangs for level 1 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyMutationNoneAvailable sinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only