We narrowed to 13,828 results for: LIC

#221829

Plasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frame

Quentin Gaudry

Mallick et al bioRxiv [Preprint]. 2024 Apr 14:2024.04.

Aug. 18, 2025

Academic Institutions and Nonprofits only

#239775

Expresses rat NF186 with a TAG codon at position 519 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.

Ivana Nikić-Spiegel

Stajkovic et al J Cell Sci. 2023 Jun 15;136(12):jcs26060

July 14, 2025

Academic Institutions and Nonprofits only

#239776

Expresses rat NF186 with a TAG codon at position 534 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.

Ivana Nikić-Spiegel

Stajkovic et al J Cell Sci. 2023 Jun 15;136(12):jcs26060

July 14, 2025

Academic Institutions and Nonprofits only

#239777

Expresses rat NF186 with a TAG codon at position 571 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.

Ivana Nikić-Spiegel

Stajkovic et al J Cell Sci. 2023 Jun 15;136(12):jcs26060

July 14, 2025

Academic Institutions and Nonprofits only

#239778

Expresses rat NF186 with a TAG codon at position 604 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.

Ivana Nikić-Spiegel

Stajkovic et al J Cell Sci. 2023 Jun 15;136(12):jcs26060

July 14, 2025

Academic Institutions and Nonprofits only

#239779

Expresses rat NF186 with a TAG codon at position 680 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.

Ivana Nikić-Spiegel

Stajkovic et al J Cell Sci. 2023 Jun 15;136(12):jcs26060

July 14, 2025

Academic Institutions and Nonprofits only

#239780

Expresses rat NF186 with a TAG codon at position 809 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.

Ivana Nikić-Spiegel

Stajkovic et al J Cell Sci. 2023 Jun 15;136(12):jcs26060

July 14, 2025

Academic Institutions and Nonprofits only

#235591

Dox-inducible expression of control catalytic-mutant Dot1l CD fused with scFV

Jamie Hackett

Policarpi et al Nat Genet. 2024 Jun;56(6):1168-1180. doi

April 30, 2025

Academic Institutions and Nonprofits only

#226281

Expresses MsCAD from trc promoter; expresses BsSfp and SrCAR from a separate trc promoter. Biosynthesis of (hydroxy)cinnamyl alcohols from (hydroxy)cinnamic acids.

Rainer Breitling

Hanko et al Microb Cell Fact. 2023 Nov 18;22(1):238.

Nov. 25, 2024

Industry, Academic Institutions, and Nonprofits

#226246

Production of ApyA peptide modified by the B12-rSAM enzyme ApyD (optional, refer to publication), the cytochrome P450 enzyme ApyO, and the MNIO enzyme ApyHI, and the methyltransferase ApyS

Wilfred van der Donk

Nguyen et al ACS Cent Sci. 2024 Apr 11;10(5):1022-103

Oct. 23, 2024

Academic Institutions and Nonprofits only